ID: 1116520999

View in Genome Browser
Species Human (GRCh38)
Location 14:45847060-45847082
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116520999_1116521002 27 Left 1116520999 14:45847060-45847082 CCCTTAAGAAACCTTCAAAGTGA No data
Right 1116521002 14:45847110-45847132 AGAAGCAATTTGTAAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116520999 Original CRISPR TCACTTTGAAGGTTTCTTAA GGG (reversed) Intergenic
No off target data available for this crispr