ID: 1116521002

View in Genome Browser
Species Human (GRCh38)
Location 14:45847110-45847132
Sequence AGAAGCAATTTGTAAATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116521000_1116521002 26 Left 1116521000 14:45847061-45847083 CCTTAAGAAACCTTCAAAGTGAG No data
Right 1116521002 14:45847110-45847132 AGAAGCAATTTGTAAATCTTTGG No data
1116520999_1116521002 27 Left 1116520999 14:45847060-45847082 CCCTTAAGAAACCTTCAAAGTGA No data
Right 1116521002 14:45847110-45847132 AGAAGCAATTTGTAAATCTTTGG No data
1116521001_1116521002 16 Left 1116521001 14:45847071-45847093 CCTTCAAAGTGAGTGAAAATTGC No data
Right 1116521002 14:45847110-45847132 AGAAGCAATTTGTAAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116521002 Original CRISPR AGAAGCAATTTGTAAATCTT TGG Intergenic