ID: 1116521407

View in Genome Browser
Species Human (GRCh38)
Location 14:45851830-45851852
Sequence ACTATGAAGGGCAATCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116521399_1116521407 25 Left 1116521399 14:45851782-45851804 CCCAGACCACAGACTGTTGCAGA No data
Right 1116521407 14:45851830-45851852 ACTATGAAGGGCAATCAAGCTGG No data
1116521403_1116521407 19 Left 1116521403 14:45851788-45851810 CCACAGACTGTTGCAGAGGAGGA No data
Right 1116521407 14:45851830-45851852 ACTATGAAGGGCAATCAAGCTGG No data
1116521400_1116521407 24 Left 1116521400 14:45851783-45851805 CCAGACCACAGACTGTTGCAGAG No data
Right 1116521407 14:45851830-45851852 ACTATGAAGGGCAATCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116521407 Original CRISPR ACTATGAAGGGCAATCAAGC TGG Intergenic