ID: 1116524744

View in Genome Browser
Species Human (GRCh38)
Location 14:45890877-45890899
Sequence CTGTTCCAATATATGATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116524741_1116524744 24 Left 1116524741 14:45890830-45890852 CCTATATTTTTAACTAGGTGGTT No data
Right 1116524744 14:45890877-45890899 CTGTTCCAATATATGATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116524744 Original CRISPR CTGTTCCAATATATGATCAT GGG Intergenic
No off target data available for this crispr