ID: 1116531518

View in Genome Browser
Species Human (GRCh38)
Location 14:45978649-45978671
Sequence CAGTAAAATGTCCAGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116531518_1116531521 4 Left 1116531518 14:45978649-45978671 CCACACCACTGGACATTTTACTG No data
Right 1116531521 14:45978676-45978698 AAAGTTCCCTGAATTTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116531518 Original CRISPR CAGTAAAATGTCCAGTGGTG TGG (reversed) Intergenic
No off target data available for this crispr