ID: 1116543835

View in Genome Browser
Species Human (GRCh38)
Location 14:46136770-46136792
Sequence CAGCACTTCCAGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116543832_1116543835 25 Left 1116543832 14:46136722-46136744 CCAGGGAAACAAAGGGACACAGA No data
Right 1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116543835 Original CRISPR CAGCACTTCCAGAGGAAAAA AGG Intergenic
No off target data available for this crispr