ID: 1116559753

View in Genome Browser
Species Human (GRCh38)
Location 14:46362893-46362915
Sequence CCATAGTTCTTGGGTAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116559753_1116559762 -6 Left 1116559753 14:46362893-46362915 CCACTCCTACCCAAGAACTATGG No data
Right 1116559762 14:46362910-46362932 CTATGGGAAAAAGGGATTCTGGG No data
1116559753_1116559764 20 Left 1116559753 14:46362893-46362915 CCACTCCTACCCAAGAACTATGG No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data
1116559753_1116559763 11 Left 1116559753 14:46362893-46362915 CCACTCCTACCCAAGAACTATGG No data
Right 1116559763 14:46362927-46362949 TCTGGGAAACAGTTCCAACTTGG No data
1116559753_1116559761 -7 Left 1116559753 14:46362893-46362915 CCACTCCTACCCAAGAACTATGG No data
Right 1116559761 14:46362909-46362931 ACTATGGGAAAAAGGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116559753 Original CRISPR CCATAGTTCTTGGGTAGGAG TGG (reversed) Intergenic
No off target data available for this crispr