ID: 1116559756

View in Genome Browser
Species Human (GRCh38)
Location 14:46362898-46362920
Sequence TTTTCCCATAGTTCTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116559756_1116559764 15 Left 1116559756 14:46362898-46362920 CCTACCCAAGAACTATGGGAAAA No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data
1116559756_1116559763 6 Left 1116559756 14:46362898-46362920 CCTACCCAAGAACTATGGGAAAA No data
Right 1116559763 14:46362927-46362949 TCTGGGAAACAGTTCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116559756 Original CRISPR TTTTCCCATAGTTCTTGGGT AGG (reversed) Intergenic
No off target data available for this crispr