ID: 1116559764

View in Genome Browser
Species Human (GRCh38)
Location 14:46362936-46362958
Sequence CAGTTCCAACTTGGTTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116559756_1116559764 15 Left 1116559756 14:46362898-46362920 CCTACCCAAGAACTATGGGAAAA No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data
1116559753_1116559764 20 Left 1116559753 14:46362893-46362915 CCACTCCTACCCAAGAACTATGG No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data
1116559760_1116559764 10 Left 1116559760 14:46362903-46362925 CCAAGAACTATGGGAAAAAGGGA No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data
1116559758_1116559764 11 Left 1116559758 14:46362902-46362924 CCCAAGAACTATGGGAAAAAGGG No data
Right 1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116559764 Original CRISPR CAGTTCCAACTTGGTTAAGT TGG Intergenic
No off target data available for this crispr