ID: 1116562389

View in Genome Browser
Species Human (GRCh38)
Location 14:46397260-46397282
Sequence TGAGATAAGCAGAGGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116562389_1116562395 29 Left 1116562389 14:46397260-46397282 CCTACCTTCCTCTGCTTATCTCA No data
Right 1116562395 14:46397312-46397334 CTTCTCAGACTCATCATTTAAGG No data
1116562389_1116562393 -5 Left 1116562389 14:46397260-46397282 CCTACCTTCCTCTGCTTATCTCA No data
Right 1116562393 14:46397278-46397300 TCTCAGGAATCTCTGACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116562389 Original CRISPR TGAGATAAGCAGAGGAAGGT AGG (reversed) Intergenic
No off target data available for this crispr