ID: 1116563379 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:46413075-46413097 |
Sequence | ATGATGGCTCTCTCCGGGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1116563373_1116563379 | 2 | Left | 1116563373 | 14:46413050-46413072 | CCAACCTTTGATCACTTGCGGGT | No data | ||
Right | 1116563379 | 14:46413075-46413097 | ATGATGGCTCTCTCCGGGATGGG | No data | ||||
1116563374_1116563379 | -2 | Left | 1116563374 | 14:46413054-46413076 | CCTTTGATCACTTGCGGGTACAT | No data | ||
Right | 1116563379 | 14:46413075-46413097 | ATGATGGCTCTCTCCGGGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1116563379 | Original CRISPR | ATGATGGCTCTCTCCGGGAT GGG | Intergenic | ||