ID: 1116563379

View in Genome Browser
Species Human (GRCh38)
Location 14:46413075-46413097
Sequence ATGATGGCTCTCTCCGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116563373_1116563379 2 Left 1116563373 14:46413050-46413072 CCAACCTTTGATCACTTGCGGGT No data
Right 1116563379 14:46413075-46413097 ATGATGGCTCTCTCCGGGATGGG No data
1116563374_1116563379 -2 Left 1116563374 14:46413054-46413076 CCTTTGATCACTTGCGGGTACAT No data
Right 1116563379 14:46413075-46413097 ATGATGGCTCTCTCCGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116563379 Original CRISPR ATGATGGCTCTCTCCGGGAT GGG Intergenic