ID: 1116563515

View in Genome Browser
Species Human (GRCh38)
Location 14:46415258-46415280
Sequence TGTGAGGGCTTGGGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116563515_1116563525 25 Left 1116563515 14:46415258-46415280 CCTCTTTTCCCCAAGCCCTCACA No data
Right 1116563525 14:46415306-46415328 AGCTCAATCCTTCTCCCTCAGGG No data
1116563515_1116563524 24 Left 1116563515 14:46415258-46415280 CCTCTTTTCCCCAAGCCCTCACA No data
Right 1116563524 14:46415305-46415327 CAGCTCAATCCTTCTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116563515 Original CRISPR TGTGAGGGCTTGGGGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr