ID: 1116565107

View in Genome Browser
Species Human (GRCh38)
Location 14:46434933-46434955
Sequence TACAGTAAGCTGAAAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116565105_1116565107 30 Left 1116565105 14:46434880-46434902 CCATCTGTAAATGTTGGGGGCAT No data
Right 1116565107 14:46434933-46434955 TACAGTAAGCTGAAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116565107 Original CRISPR TACAGTAAGCTGAAAGATAG AGG Intergenic
No off target data available for this crispr