ID: 1116565420

View in Genome Browser
Species Human (GRCh38)
Location 14:46438849-46438871
Sequence GCAGCCTAAACAAAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116565414_1116565420 12 Left 1116565414 14:46438814-46438836 CCATTACTGAGGCTTCAGTAGGT No data
Right 1116565420 14:46438849-46438871 GCAGCCTAAACAAAACCCCAGGG No data
1116565412_1116565420 15 Left 1116565412 14:46438811-46438833 CCACCATTACTGAGGCTTCAGTA 0: 29
1: 484
2: 1475
3: 1135
4: 732
Right 1116565420 14:46438849-46438871 GCAGCCTAAACAAAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116565420 Original CRISPR GCAGCCTAAACAAAACCCCA GGG Intergenic
No off target data available for this crispr