ID: 1116565982

View in Genome Browser
Species Human (GRCh38)
Location 14:46444736-46444758
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116565982_1116565987 23 Left 1116565982 14:46444736-46444758 CCCTCTGTCCTCTGGTCTCCTGG No data
Right 1116565987 14:46444782-46444804 CGAGACAAGAAACTTGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116565982 Original CRISPR CCAGGAGACCAGAGGACAGA GGG (reversed) Intergenic
No off target data available for this crispr