ID: 1116574127

View in Genome Browser
Species Human (GRCh38)
Location 14:46551598-46551620
Sequence TTATGCTGCTCCTAATTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116574127_1116574133 29 Left 1116574127 14:46551598-46551620 CCCCCTAATTAGGAGCAGCATAA No data
Right 1116574133 14:46551650-46551672 TTGAAGCAGTATCAAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116574127 Original CRISPR TTATGCTGCTCCTAATTAGG GGG (reversed) Intergenic
No off target data available for this crispr