ID: 1116576368

View in Genome Browser
Species Human (GRCh38)
Location 14:46581314-46581336
Sequence CAAAATGCACAAAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116576361_1116576368 24 Left 1116576361 14:46581267-46581289 CCACTGGAGGGCGACCAAGTTCT No data
Right 1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG No data
1116576363_1116576368 10 Left 1116576363 14:46581281-46581303 CCAAGTTCTTGGCGTCTTGAACA No data
Right 1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116576368 Original CRISPR CAAAATGCACAAAGGAAGGA AGG Intergenic
No off target data available for this crispr