ID: 1116576586

View in Genome Browser
Species Human (GRCh38)
Location 14:46583054-46583076
Sequence GATCCCTTTTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116576583_1116576586 17 Left 1116576583 14:46583014-46583036 CCTCTTTTACTTTAAACCACAGA No data
Right 1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG No data
1116576585_1116576586 1 Left 1116576585 14:46583030-46583052 CCACAGAAAAAGGAACTAACAAA No data
Right 1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116576586 Original CRISPR GATCCCTTTTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr