ID: 1116583586

View in Genome Browser
Species Human (GRCh38)
Location 14:46674299-46674321
Sequence GAGGGAAGCACAGTGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116583583_1116583586 24 Left 1116583583 14:46674252-46674274 CCTGGCAGCAGACACATGGCACA No data
Right 1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG No data
1116583581_1116583586 26 Left 1116583581 14:46674250-46674272 CCCCTGGCAGCAGACACATGGCA No data
Right 1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG No data
1116583579_1116583586 30 Left 1116583579 14:46674246-46674268 CCATCCCCTGGCAGCAGACACAT No data
Right 1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG No data
1116583582_1116583586 25 Left 1116583582 14:46674251-46674273 CCCTGGCAGCAGACACATGGCAC No data
Right 1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116583586 Original CRISPR GAGGGAAGCACAGTGATTGA AGG Intergenic
No off target data available for this crispr