ID: 1116584917

View in Genome Browser
Species Human (GRCh38)
Location 14:46691090-46691112
Sequence TTATTACTCTAGCCATTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116584913_1116584917 28 Left 1116584913 14:46691039-46691061 CCTCTAGGCCCTAGAGTGAATGA No data
Right 1116584917 14:46691090-46691112 TTATTACTCTAGCCATTGGTTGG No data
1116584914_1116584917 20 Left 1116584914 14:46691047-46691069 CCCTAGAGTGAATGATGAATGTT No data
Right 1116584917 14:46691090-46691112 TTATTACTCTAGCCATTGGTTGG No data
1116584915_1116584917 19 Left 1116584915 14:46691048-46691070 CCTAGAGTGAATGATGAATGTTC No data
Right 1116584917 14:46691090-46691112 TTATTACTCTAGCCATTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116584917 Original CRISPR TTATTACTCTAGCCATTGGT TGG Intergenic
No off target data available for this crispr