ID: 1116585125

View in Genome Browser
Species Human (GRCh38)
Location 14:46693951-46693973
Sequence GGGAACAAAAGGAAGACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116585125_1116585127 -9 Left 1116585125 14:46693951-46693973 CCAGTAGTCTTCCTTTTGTTCCC No data
Right 1116585127 14:46693965-46693987 TTTGTTCCCAAATAGATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116585125 Original CRISPR GGGAACAAAAGGAAGACTAC TGG (reversed) Intergenic
No off target data available for this crispr