ID: 1116585482

View in Genome Browser
Species Human (GRCh38)
Location 14:46697723-46697745
Sequence AGGTTTTAACAGATGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116585472_1116585482 20 Left 1116585472 14:46697680-46697702 CCTCCCAAAGATCCCACCTCCAA No data
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585476_1116585482 7 Left 1116585476 14:46697693-46697715 CCACCTCCAAATACCATCACATT 0: 85
1: 504
2: 1338
3: 2280
4: 3455
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585475_1116585482 8 Left 1116585475 14:46697692-46697714 CCCACCTCCAAATACCATCACAT 0: 77
1: 517
2: 1356
3: 2690
4: 4452
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585474_1116585482 16 Left 1116585474 14:46697684-46697706 CCAAAGATCCCACCTCCAAATAC No data
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585478_1116585482 4 Left 1116585478 14:46697696-46697718 CCTCCAAATACCATCACATTGGT No data
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585471_1116585482 28 Left 1116585471 14:46697672-46697694 CCTAATCACCTCCCAAAGATCCC 0: 9
1: 130
2: 735
3: 1986
4: 3570
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585473_1116585482 17 Left 1116585473 14:46697683-46697705 CCCAAAGATCCCACCTCCAAATA No data
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585481_1116585482 -6 Left 1116585481 14:46697706-46697728 CCATCACATTGGTGATTAGGTTT 0: 31
1: 136
2: 358
3: 865
4: 1724
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data
1116585479_1116585482 1 Left 1116585479 14:46697699-46697721 CCAAATACCATCACATTGGTGAT 0: 29
1: 190
2: 685
3: 1756
4: 2851
Right 1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116585482 Original CRISPR AGGTTTTAACAGATGAATTT TGG Intergenic
No off target data available for this crispr