ID: 1116590518

View in Genome Browser
Species Human (GRCh38)
Location 14:46765562-46765584
Sequence TAGTGGGACAAGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116590518_1116590527 8 Left 1116590518 14:46765562-46765584 CCACTCCACATCTTGTCCCACTA No data
Right 1116590527 14:46765593-46765615 TTAGGGGCAATAACAGACATGGG No data
1116590518_1116590523 -8 Left 1116590518 14:46765562-46765584 CCACTCCACATCTTGTCCCACTA No data
Right 1116590523 14:46765577-46765599 TCCCACTATAAGGTGTTTAGGGG No data
1116590518_1116590526 7 Left 1116590518 14:46765562-46765584 CCACTCCACATCTTGTCCCACTA No data
Right 1116590526 14:46765592-46765614 TTTAGGGGCAATAACAGACATGG No data
1116590518_1116590521 -10 Left 1116590518 14:46765562-46765584 CCACTCCACATCTTGTCCCACTA No data
Right 1116590521 14:46765575-46765597 TGTCCCACTATAAGGTGTTTAGG No data
1116590518_1116590522 -9 Left 1116590518 14:46765562-46765584 CCACTCCACATCTTGTCCCACTA No data
Right 1116590522 14:46765576-46765598 GTCCCACTATAAGGTGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116590518 Original CRISPR TAGTGGGACAAGATGTGGAG TGG (reversed) Intergenic
No off target data available for this crispr