ID: 1116595142 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:46832345-46832367 |
| Sequence | CGGTCAATAGAGATGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116595142_1116595151 | 30 | Left | 1116595142 | 14:46832345-46832367 | CCTTCCACCATCTCTATTGACCG | No data | ||
| Right | 1116595151 | 14:46832398-46832420 | CAATTGTCAATAACCATCCTAGG | No data | ||||
| 1116595142_1116595147 | 2 | Left | 1116595142 | 14:46832345-46832367 | CCTTCCACCATCTCTATTGACCG | No data | ||
| Right | 1116595147 | 14:46832370-46832392 | AACCTCTGGTGCCAAAACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116595142 | Original CRISPR | CGGTCAATAGAGATGGTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||