ID: 1116595142

View in Genome Browser
Species Human (GRCh38)
Location 14:46832345-46832367
Sequence CGGTCAATAGAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116595142_1116595151 30 Left 1116595142 14:46832345-46832367 CCTTCCACCATCTCTATTGACCG No data
Right 1116595151 14:46832398-46832420 CAATTGTCAATAACCATCCTAGG No data
1116595142_1116595147 2 Left 1116595142 14:46832345-46832367 CCTTCCACCATCTCTATTGACCG No data
Right 1116595147 14:46832370-46832392 AACCTCTGGTGCCAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116595142 Original CRISPR CGGTCAATAGAGATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr