ID: 1116596587

View in Genome Browser
Species Human (GRCh38)
Location 14:46856460-46856482
Sequence TCTAGCAAAGGGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116596587_1116596593 -8 Left 1116596587 14:46856460-46856482 CCAGCCACCCTCCCTTTGCTAGA 0: 1
1: 0
2: 1
3: 25
4: 196
Right 1116596593 14:46856475-46856497 TTGCTAGATAACTAGTAATCAGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116596587 Original CRISPR TCTAGCAAAGGGAGGGTGGC TGG (reversed) Intronic
901806931 1:11744467-11744489 GCGGGCAAAGGGAGGGTAGCTGG - Intronic
901814252 1:11785004-11785026 TCCAGAAAAGGGAGTGTGGGAGG + Intronic
902645021 1:17791931-17791953 GATAGCAAAGAGATGGTGGCAGG - Intronic
902788029 1:18745581-18745603 TCTAGCACAGGCAGGGAGACTGG + Intronic
903868388 1:26414337-26414359 TCTACCAGAGGGAGGGGGTCAGG + Intronic
906920023 1:50054299-50054321 TCTGGAAAAGGGAGGAAGGCAGG + Intronic
907329189 1:53660282-53660304 TGTGGCAGAGGGAGGATGGCTGG - Intronic
909563694 1:77032206-77032228 TCGAGCAAAGGCAGTGTGGCTGG + Intronic
910046330 1:82921603-82921625 TGGAGCAAAGTCAGGGTGGCAGG + Intergenic
911017106 1:93345634-93345656 TCTGGGAAGGGGTGGGTGGCTGG - Intergenic
914331106 1:146671501-146671523 TCTAGAAAAGGGTGGGTCCCTGG - Intergenic
915308262 1:154993478-154993500 TCTAGCAAAGGGAAGGTTCTAGG - Intergenic
915934146 1:160081044-160081066 TCTACTAAAGGAAGGGAGGCAGG - Intergenic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
917804337 1:178599699-178599721 TCTGGCAAAGGGAGGGAGAAAGG + Intergenic
921339788 1:214123307-214123329 TCTAGCAAAGGGAAAGAGCCAGG - Intergenic
923628792 1:235636055-235636077 TCTAGCAAGAGGAGGGTTCCTGG - Intronic
923850666 1:237790760-237790782 ACTAGGAAATGGAGGGAGGCAGG + Intronic
1062827309 10:582139-582161 TGTAGCAGGGGGTGGGTGGCCGG - Intronic
1063437309 10:6044790-6044812 TCCAGCAAAGAGTGGGTGGAGGG - Intronic
1063801973 10:9590148-9590170 TCTAGCTAAGACAAGGTGGCTGG - Intergenic
1064869959 10:19926349-19926371 TCTGCCATAGGGTGGGTGGCAGG + Intronic
1066497106 10:35953134-35953156 ACTATCAAAGGGAGGGAGGGAGG + Intergenic
1069208195 10:65719990-65720012 TTTAGCAAACAGATGGTGGCTGG + Intergenic
1072844718 10:98817058-98817080 TCAACCAAAGGGAGGGAGGGAGG - Intronic
1073082451 10:100868629-100868651 TCTAGCCAGGGGATGGGGGCAGG - Intergenic
1073178115 10:101568908-101568930 TCAAACAAGGGGAGGGAGGCTGG + Intergenic
1074348238 10:112709447-112709469 TCAAGCGAGGGGAGGGTGGCTGG - Intronic
1077437291 11:2549083-2549105 TCCACCCAAGGGAGAGTGGCTGG + Intronic
1079231798 11:18655538-18655560 TTTAAAAAAGGGAGGGGGGCTGG - Intergenic
1079802215 11:24884003-24884025 AATTGCAAAGAGAGGGTGGCAGG + Intronic
1080662725 11:34310670-34310692 ACTAGCAGAGGGAGGGTGCTGGG - Intronic
1080853490 11:36091486-36091508 TCTGGCAGAGGGAGGGAGGGAGG - Intronic
1082796359 11:57380882-57380904 TCTAGAAAAGGAATGGTGGGAGG + Intronic
1083152088 11:60798209-60798231 TCAAGAACAGGGAGGGTGGAGGG + Intronic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1084351399 11:68602514-68602536 GCTAGCAAAGGGAGTGTGATGGG + Intronic
1084797880 11:71520200-71520222 GCTAGAAAAAGGAGGGTGGCTGG + Intronic
1084803592 11:71564017-71564039 GCTAGAAAGAGGAGGGTGGCTGG + Intronic
1092800704 12:12163271-12163293 TCTTGAAAATGGGGGGTGGCTGG - Intronic
1096196082 12:49649630-49649652 ACTAGCAGATGGAGGGTGGAGGG + Intronic
1096476324 12:51911419-51911441 TCTAGGAAAGGGTGGGTGGAGGG - Intronic
1097050859 12:56222281-56222303 TCTGGAAAAGGGAGAGGGGCCGG - Intronic
1097294039 12:57943862-57943884 TCTTCCAAGGGCAGGGTGGCTGG + Intronic
1099508593 12:83507449-83507471 GGTAGAAAAGGCAGGGTGGCAGG - Intergenic
1100474120 12:94919899-94919921 TATAGCAAGAGGAGAGTGGCAGG + Intronic
1101573274 12:105974901-105974923 TCTAGAAAATGGATGGAGGCTGG - Intergenic
1103437236 12:120936436-120936458 ACTTGCAGAGGGAGGGAGGCAGG - Intergenic
1104166700 12:126238496-126238518 ACTAGTAAGGGGAGGTTGGCTGG - Intergenic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1107057689 13:36124763-36124785 TCTGGGAAAGGGAGGTTGGATGG - Intronic
1108640833 13:52380938-52380960 TCTGGCATAGTGAGGGAGGCTGG - Intronic
1108822027 13:54363529-54363551 ACTAGCAAAAAGAGGGAGGCAGG + Intergenic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1114559055 14:23577994-23578016 TCTGGCAAAGGGATGGGGGTGGG + Exonic
1116596587 14:46856460-46856482 TCTAGCAAAGGGAGGGTGGCTGG - Intronic
1118269234 14:64326918-64326940 TCTCCCAAAGGGAGGGTAGAAGG - Intronic
1118376826 14:65184687-65184709 TCTGGCAAGGGCAGAGTGGCAGG + Intergenic
1119853028 14:77879536-77879558 TCTAGCAGAGGGAGGAGGGTGGG + Intronic
1120576186 14:86183804-86183826 TCTAACAGAGGAAGGGTTGCAGG + Intergenic
1121605568 14:95237542-95237564 GCCAGGAGAGGGAGGGTGGCAGG + Intronic
1124213288 15:27781959-27781981 TCTAGCACAGGAATGGTGCCTGG - Intronic
1124645007 15:31432386-31432408 TCAAGAAAAGGGAGGGAGGGAGG - Intronic
1124783551 15:32658503-32658525 TATGGGGAAGGGAGGGTGGCAGG + Intronic
1124877420 15:33608280-33608302 GATAGCAAAGGGAGGTTGGAGGG - Intronic
1125930699 15:43598121-43598143 TCTAGCTAAGGGAGGGTCCAGGG + Intronic
1125943866 15:43697942-43697964 TCTAGCTAAGGGAGGGTCCAGGG + Intronic
1127392826 15:58520916-58520938 TCTAGAAAAGGAAGGGAGGAGGG + Intronic
1128335048 15:66780373-66780395 TCAAGCACAGGGAGGCGGGCTGG - Intronic
1128441151 15:67710025-67710047 TCTAAAAAAGGGTGGGGGGCAGG - Intronic
1128725617 15:69986532-69986554 CCTAGGAAAAGGAGGGTGGTGGG + Intergenic
1130007608 15:80115517-80115539 AGTAGCAAAGGGAGGGAGGCAGG + Intronic
1133178692 16:4036040-4036062 TTTAGTGAAGGGAGGGGGGCTGG - Intronic
1133271146 16:4611386-4611408 GCCAGCCAAGGGCGGGTGGCTGG - Intronic
1133698622 16:8288404-8288426 TCTGGCAAACGAGGGGTGGCTGG - Intergenic
1136911387 16:34147173-34147195 CCCAGCCAGGGGAGGGTGGCGGG - Intergenic
1138115975 16:54361039-54361061 TCTAGAAAGGGAAGGGGGGCAGG - Intergenic
1140002448 16:71039403-71039425 TCTAGAAAAGGGTGGGTCCCTGG + Intronic
1142426038 16:90002854-90002876 TCTGGCAGAGGGAGGGAGGCAGG - Intergenic
1143343486 17:6232397-6232419 TCCAGCAGAGGGAGAGGGGCTGG + Intergenic
1144258776 17:13496917-13496939 TCTAGCAAGTGGGGGGTTGCGGG - Intronic
1144964075 17:19064547-19064569 TCTACCAAGGGGGGGGGGGCGGG + Intergenic
1145288238 17:21522342-21522364 TCCCGCAAAGTGAGGGAGGCGGG + Intergenic
1146507365 17:33416924-33416946 TCTAGCATGGGCAGGGAGGCAGG - Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1146935945 17:36812848-36812870 TCCAGAAAAGGGAGGCTGGGAGG + Intergenic
1146942685 17:36854860-36854882 CCTAGCAATGGGAGGAGGGCTGG + Intergenic
1151246088 17:72796079-72796101 CCTAGCAAATGGAGGCTGGTTGG - Intronic
1151663306 17:75531216-75531238 TCTTCCAAAGGGAGGGTCCCGGG - Intronic
1151698076 17:75728156-75728178 TACAGCAAGGGCAGGGTGGCTGG - Intronic
1153342930 18:3994091-3994113 CCTAGGAAAGGGAGGGTCACAGG - Intronic
1153411445 18:4798310-4798332 TCTAGAAAAGGAAGGGGTGCTGG - Intergenic
1154153701 18:11927613-11927635 TCCAGGGAAGGGAGAGTGGCTGG - Intergenic
1155935229 18:31746434-31746456 TCCAGGAAAGGGAGAGTGGCTGG - Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156767773 18:40679353-40679375 TCAAGCAAAGGAGGGATGGCAGG + Intergenic
1157607552 18:48935447-48935469 TCCCGCAAAGGGAGGGTGCCCGG + Intronic
1158397750 18:57092852-57092874 TGTGGCCAAGGGAGGGTGTCAGG + Intergenic
1158860275 18:61584734-61584756 TCTACCAAAGGGCAGGTGCCAGG - Intergenic
1159091393 18:63853113-63853135 TTTAGTAAAGGGAATGTGGCAGG - Intergenic
1160279193 18:77471289-77471311 TCGTGCAGAGGGAGGGTGGGGGG + Intergenic
1161890717 19:7034361-7034383 TCTAGCAGAGTTAGGGTGGCAGG + Intergenic
1161890733 19:7036370-7036392 TCTAGCAGAGTTAGGGTGGCAGG - Intergenic
1161892802 19:7053096-7053118 TCTAGCAGAGTTAGGGTGGCAGG + Intergenic
1161892818 19:7054834-7054856 TCTAGCAGAGTTAGGGTGGCAGG - Intergenic
1164061464 19:21679177-21679199 TAGAGCAGAGGGAGGCTGGCTGG + Intergenic
1166338596 19:42123364-42123386 GGTGGCCAAGGGAGGGTGGCAGG + Intronic
1166459229 19:42971572-42971594 TCTTGGAAAGGGAGGGAGGAAGG - Intronic
1166663384 19:44661912-44661934 TCTGGCACAGGGAGGGAGGCTGG - Exonic
926056347 2:9776252-9776274 TCTAGCCAAGGCTGGGGGGCAGG - Intergenic
927206097 2:20611627-20611649 TCTACCAAAGGGAGGGTAGATGG - Intronic
929592011 2:43153642-43153664 TCCAGGCAAGGGAGGGTGGGAGG + Intergenic
929604454 2:43225752-43225774 TCTGCCAAAGGGAGGGGAGCGGG + Exonic
931091750 2:58893875-58893897 TCTGATAAAGGGAGGCTGGCTGG - Intergenic
934312876 2:91885868-91885890 TCTATCAAAGGGGCGGGGGCAGG + Intergenic
935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG + Intergenic
936592564 2:113818027-113818049 GCAAGCAAAGGGAGAGGGGCAGG - Intergenic
939542906 2:143515189-143515211 TAAAGAAAAGGGAGGGTGGGGGG - Intronic
939579369 2:143930169-143930191 AATATCAAAGGGAGGGAGGCTGG + Intergenic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
943266201 2:185736467-185736489 TCTAGTAAAGGGAGACTGACAGG + Intergenic
945597690 2:211815855-211815877 TCCAGCAAAGGGAGAGTGAGAGG - Intronic
947880524 2:233506601-233506623 TCTAACAAAGGGAGCTGGGCGGG + Intronic
947993968 2:234511664-234511686 TCTATCAAAAGGCGTGTGGCAGG - Intergenic
1168965712 20:1896670-1896692 ACTAGCAAAGAGTGGGTGGAAGG + Intronic
1168997781 20:2145762-2145784 CCAAGGAAAGGCAGGGTGGCGGG - Exonic
1170713903 20:18816105-18816127 TATTTCTAAGGGAGGGTGGCAGG - Intronic
1171002644 20:21430179-21430201 CCTTGCCAAGGGAGTGTGGCGGG - Intergenic
1172278401 20:33693879-33693901 TCTGGGAAAAGGGGGGTGGCGGG + Intergenic
1172299196 20:33836916-33836938 TCTAGCCAAGACAGGATGGCAGG - Intronic
1173872558 20:46351065-46351087 TCTCACAAAAGGAGGCTGGCGGG - Intronic
1173903800 20:46611037-46611059 CCAAGCAAAGGCAGGGAGGCAGG - Intronic
1175107583 20:56626242-56626264 TGCCGCGAAGGGAGGGTGGCGGG + Intergenic
1175489353 20:59368955-59368977 TTGAGCAAAGGGAGAGGGGCTGG + Intergenic
1175978974 20:62727608-62727630 GATAGCACAGAGAGGGTGGCTGG + Intronic
1176390611 21:6161192-6161214 TCCGGAAACGGGAGGGTGGCGGG + Intergenic
1179732856 21:43377047-43377069 TCCGGAAACGGGAGGGTGGCGGG - Intergenic
1180164514 21:46017031-46017053 TCTAGCAAAGGGAGGGAGGGAGG + Intergenic
1181624624 22:24114795-24114817 TCCAGCCAGGGGAGGCTGGCAGG - Intronic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182795315 22:32987460-32987482 TCTGGCAATGGGAAGGTGCCAGG - Intronic
1183599542 22:38831985-38832007 TCCAGCAAAGGGAGAGAGGGAGG + Intronic
1184611505 22:45606843-45606865 TCCAGGAAAGGGAGAGGGGCTGG + Intergenic
1185158131 22:49206508-49206530 GCAGGCAGAGGGAGGGTGGCTGG - Intergenic
949649731 3:6143046-6143068 TCCAACAAAGGGAGGGAGGAAGG + Intergenic
949862627 3:8520480-8520502 TTTAGGAAAGGCAGGGTGGGAGG + Intronic
949953798 3:9251132-9251154 TATGGCAAAGGGAGTGAGGCGGG + Intronic
951207277 3:19938080-19938102 TCCAGCAAAGGCATGGAGGCAGG - Intronic
952836382 3:37605805-37605827 TCTCTCTAAGGGAGGGCGGCTGG + Intronic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
954720308 3:52556018-52556040 TCTTGCAAAGGGAGGGTTGAGGG + Intronic
954955699 3:54516821-54516843 GCTATCAAAGGCAGGGTGGGAGG + Intronic
957126888 3:76172946-76172968 TCAAGCAAAGGTAGGATGACTGG + Intronic
961536246 3:127572798-127572820 TCTGACAAAGGGAGAGGGGCTGG + Intergenic
965447978 3:168799578-168799600 ACTTACAAAGGGAGGGTGTCTGG + Intergenic
967843439 3:194025827-194025849 TCTTGTAGAGTGAGGGTGGCAGG - Intergenic
970221757 4:13818953-13818975 ACTAGCAAAGGTAGGGAGACTGG - Intergenic
970508771 4:16759388-16759410 TCTAGGAAAGGGTAGGTGGGCGG + Intronic
975558347 4:75686545-75686567 AAGAGCAAAGGGTGGGTGGCGGG + Intronic
980648571 4:135679216-135679238 TCTAGCCAAGGAAGTGAGGCAGG + Intergenic
985695158 5:1335948-1335970 TCCAGCACGTGGAGGGTGGCGGG - Intronic
986044926 5:4027562-4027584 TGGAGCAAAGCAAGGGTGGCAGG - Intergenic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
989600048 5:43192452-43192474 CCTAGCAGAGGAAGGGTGGCGGG - Intronic
994368962 5:98947544-98947566 TCCAGGAAAGGGAGTGGGGCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
997303624 5:132823678-132823700 TCAAGCACAGGGTGGGTGGCAGG + Exonic
997446305 5:133942890-133942912 CCTAGCAGAAGGAGGGTGGTTGG + Intergenic
998818891 5:146040768-146040790 TCAAGAACAGGGAGGGTTGCAGG + Intronic
1000230309 5:159309891-159309913 CCCAGCAAAGGGCTGGTGGCTGG + Intergenic
1003668274 6:8131724-8131746 TTTAGCAAATGGAGAGTGTCAGG + Intergenic
1004830582 6:19473325-19473347 TCTAGCCAAGTGATGATGGCTGG + Intergenic
1008099536 6:47376598-47376620 TTTAGCAAGGGGAGGCAGGCAGG - Intergenic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1011522612 6:88225897-88225919 TCTAGCCAAGGGAATGTGGGGGG + Intergenic
1013076200 6:106773860-106773882 TGTAGCAAAGGGAGGTGGGGAGG - Intergenic
1013244345 6:108272323-108272345 AATAGAAAAGGGAGGATGGCTGG - Intergenic
1014157637 6:118129558-118129580 TCTAGAAAGGGGATGGTGGCTGG + Intronic
1014492061 6:122074763-122074785 TCAAACAAATGGAGGATGGCAGG + Intergenic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1017529166 6:155270658-155270680 TCTAGCATAAGGAAGCTGGCTGG - Intronic
1022199018 7:28097790-28097812 TGTAGAAATGGGAGGGTGACAGG + Intronic
1023126081 7:36955622-36955644 TCTGTCAAAGGTAGGGTGCCAGG + Intronic
1024285936 7:47757636-47757658 TGAAGCAAATGGTGGGTGGCCGG + Intronic
1024585980 7:50842563-50842585 TATAGCAAAGGCAGGGCTGCGGG + Intergenic
1026161592 7:67874334-67874356 TCAAGCTAATGGAGGGTGGGAGG - Intergenic
1026865808 7:73823302-73823324 TCTCGCAAAAGGAGAGTAGCAGG - Intronic
1029358808 7:100073075-100073097 TCTAGCAGAGAGATGGTGGCAGG + Intronic
1034430504 7:151038937-151038959 TCTAGCAGAGAGAGGGGAGCAGG + Intronic
1034915379 7:155034645-155034667 TCCCGGACAGGGAGGGTGGCTGG - Intergenic
1035307297 7:157941717-157941739 CCCAGCATAGGGAGTGTGGCTGG - Intronic
1036485816 8:9177870-9177892 TTTTGTAAAGGGAGGGTTGCAGG + Intergenic
1039940389 8:42085232-42085254 ACTAGCAGAGGCAGGGTGCCTGG + Intergenic
1042046873 8:64663136-64663158 TCTAGCAAGGAGAGGATGGAGGG - Intronic
1046327656 8:112671201-112671223 TCTAGGAAAGGGAGGTGGGAAGG - Intronic
1046477285 8:114762311-114762333 TCAAGCAAAAGGAGGTTGCCAGG - Intergenic
1048299532 8:133241017-133241039 TCTAGCAAGGCGAGGCTGGCAGG - Intronic
1048986457 8:139737562-139737584 ACCAGGAAATGGAGGGTGGCAGG - Intronic
1049682964 8:143927876-143927898 TCGAGCTCCGGGAGGGTGGCCGG + Exonic
1049720319 8:144112587-144112609 TGTAGCAAAGGGGAGATGGCAGG - Intronic
1049849215 8:144821787-144821809 CCTAGAGGAGGGAGGGTGGCCGG - Intergenic
1052800943 9:32967630-32967652 TCTATCAAAAGGAGGTTTGCGGG + Intergenic
1060628979 9:125139008-125139030 TGGAGCAGAGGGAGGGTGGGGGG + Intronic
1060775742 9:126372895-126372917 ACGAGCAAAGGCAGGGAGGCAGG + Intronic
1061147432 9:128808149-128808171 TCTGGCACTGGGAGGCTGGCAGG + Exonic
1062030414 9:134359648-134359670 TCCAGCAGAGGGAGGGAGGGAGG - Intronic
1062135499 9:134925273-134925295 GGGAGAAAAGGGAGGGTGGCAGG - Intergenic
1062171121 9:135135354-135135376 TCTAGCCAAGGAAGTGTGGGTGG - Intergenic
1062566215 9:137165052-137165074 TCCAGCACAGGGAGGCAGGCAGG + Intronic
1185836196 X:3347204-3347226 TCTGGCAAGGGGAGGGAGGCGGG - Intergenic
1186185808 X:7018706-7018728 TCTTGGAAAGGGAGGGAGGAAGG - Intergenic
1186994999 X:15111303-15111325 TGTAGCAAAGGGACTGTGGCTGG + Intergenic
1187250559 X:17594381-17594403 TCTATGAGAGGGTGGGTGGCAGG + Intronic
1188504936 X:30872389-30872411 TTGAGAAAAGGTAGGGTGGCAGG - Intronic
1189839555 X:45059518-45059540 TCAGGCAGAAGGAGGGTGGCTGG + Intronic
1190816148 X:53931549-53931571 TCCAGCAAAGGCATGGAGGCAGG - Intergenic
1191025642 X:55909955-55909977 TTCTGCACAGGGAGGGTGGCAGG + Intergenic
1191088011 X:56589186-56589208 TGGAGCAAAGGGAGAGTGGGGGG + Intergenic
1192319982 X:70082968-70082990 TCTGGCAAAGTGAGAGTGGCAGG + Intergenic
1197325043 X:125082455-125082477 TTTAGCAATAGGAGGGAGGCAGG - Intergenic
1200080051 X:153571805-153571827 TCCAGCAGAAGGTGGGTGGCAGG + Intronic
1200238257 X:154479451-154479473 ATTCGCAGAGGGAGGGTGGCCGG + Intergenic
1201318981 Y:12676798-12676820 TCAATCAAAGGGAGGCTGGTGGG + Intergenic