ID: 1116599308

View in Genome Browser
Species Human (GRCh38)
Location 14:46899040-46899062
Sequence TCGCAGCCGCTAATGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116599297_1116599308 28 Left 1116599297 14:46898989-46899011 CCTTGGAGACACTATAAAATTAG 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1116599303_1116599308 -4 Left 1116599303 14:46899021-46899043 CCTGAACCTAAGGGGAAAATCGC 0: 1
1: 0
2: 0
3: 0
4: 60
Right 1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1116599304_1116599308 -10 Left 1116599304 14:46899027-46899049 CCTAAGGGGAAAATCGCAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116599308 Original CRISPR TCGCAGCCGCTAATGGAAAG GGG Intronic
902302807 1:15514479-15514501 TCTCAGCAGCTCATGGAAAATGG + Intronic
904003481 1:27351212-27351234 GAGCAGGGGCTAATGGAAAGGGG - Intronic
912470836 1:109905718-109905740 CAGCAGCAGCCAATGGAAAGGGG + Intergenic
921051346 1:211514133-211514155 TCGCCGCTGCTAATGGTTAGAGG - Intergenic
923837096 1:237624122-237624144 TTCCTGCCACTAATGGAAAGAGG - Intronic
923892543 1:238232075-238232097 TCGGAGCAGCTAATGAAAACAGG + Intergenic
1064107077 10:12509166-12509188 TAGCAGCCGCCAATGGGAAGGGG + Intronic
1078015238 11:7607726-7607748 TCCCAGCTGCCAATGCAAAGGGG - Intronic
1078581986 11:12545935-12545957 TCTCGGCCTTTAATGGAAAGAGG - Intergenic
1100382495 12:94074711-94074733 TGGCAGTCCCTAATGGAAAGTGG + Intergenic
1116380124 14:44257424-44257446 TCCCAGCTGTTAAAGGAAAGGGG - Intergenic
1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG + Intronic
1125388127 15:39160209-39160231 TCACAGCAGCAAATGGAAAATGG - Intergenic
1134678255 16:16105480-16105502 TCCCAGGCGCTAATTCAAAGAGG + Intronic
1144930243 17:18853169-18853191 TCGCTGCGGTTAATAGAAAGTGG + Intronic
1146351331 17:32097052-32097074 TGGCAACAGCTAATGGCAAGAGG + Intergenic
1156592214 18:38503513-38503535 TAGCAGACGCCAATGGGAAGGGG - Intergenic
1159301076 18:66568705-66568727 TCTTAGCTGCAAATGGAAAGAGG + Exonic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163398526 19:17077759-17077781 TCGCAGCCAGGAATGGAGAGTGG - Intronic
926143518 2:10383049-10383071 TTGCAGACTCTAATGGTAAGGGG - Intronic
948879447 2:240849089-240849111 TCTCAGCCTCTAATGTACAGCGG - Intergenic
1169143826 20:3239927-3239949 TCGCAGCCGGTCCAGGAAAGGGG - Intergenic
1170574598 20:17652831-17652853 TCACAGCCGCCAATGTTAAGTGG + Intronic
1173823348 20:46032138-46032160 CCGCAGCCGCTTATGTAACGCGG - Intronic
1174935645 20:54865327-54865349 TACCAGCAGCTAATGGAAAGAGG - Intergenic
1178962111 21:37074219-37074241 CCACAGACGCTAATGGGAAGGGG + Intronic
1179407698 21:41138994-41139016 AGGCACCCGCTCATGGAAAGGGG + Intergenic
956002735 3:64746744-64746766 TTGCAGCCCCTAATGGAAGATGG - Intergenic
956446244 3:69329062-69329084 TCTCAGCTGTTACTGGAAAGTGG - Intronic
968057591 3:195704498-195704520 TGGCAGCCCCTAATGAGAAGTGG - Intergenic
971068553 4:23063397-23063419 TCACAGCAGCCAATGCAAAGCGG - Intergenic
980087241 4:128403836-128403858 TCCCAGCTGCTAAAGAAAAGGGG + Intergenic
985824064 5:2180022-2180044 GCGCAGCCGCTCCTGGAAGGGGG - Intergenic
986637696 5:9839107-9839129 GCGCAGCCGCTAGGGTAAAGAGG + Intergenic
987856092 5:23422731-23422753 TTGCAGCTGCTGATGGAGAGAGG - Intergenic
988464917 5:31480446-31480468 TCTCAGCAGCGACTGGAAAGGGG + Intronic
1005327778 6:24719832-24719854 TCGCTGCCGCTGAAGGCAAGGGG - Exonic
1007421567 6:41723028-41723050 TCCCAGCCCCTAATGTAAATGGG + Intronic
1012989316 6:105908766-105908788 TGGCAGGCGCTACGGGAAAGAGG + Intergenic
1028003333 7:85529822-85529844 CCTCAGCCCCTAATAGAAAGAGG - Intergenic
1030085105 7:105809146-105809168 TCGCAGCTTATAAAGGAAAGAGG - Intronic
1030385811 7:108866771-108866793 TCTCAGAGGCTAAAGGAAAGAGG - Intergenic
1031610194 7:123817309-123817331 ACCCATCCGATAATGGAAAGAGG - Intergenic
1032591381 7:133194868-133194890 ACGAAGCCAGTAATGGAAAGGGG + Intergenic
1033031867 7:137834580-137834602 TCCCAGCTGCTCCTGGAAAGGGG + Intronic
1051136720 9:13931091-13931113 TAGCAACTGCTAATGGAAATAGG - Intergenic
1061239546 9:129361603-129361625 ACTCAGCCGCCACTGGAAAGGGG - Intergenic
1197175566 X:123482190-123482212 TCTCAGCCACTAGGGGAAAGAGG + Intronic