ID: 1116606738

View in Genome Browser
Species Human (GRCh38)
Location 14:47008313-47008335
Sequence TTCTGCCAACACTACCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116606738_1116606741 13 Left 1116606738 14:47008313-47008335 CCTAACAGGTAGTGTTGGCAGAA 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1116606741 14:47008349-47008371 AATGTTATTGTTCTCCTAATTGG 0: 1
1: 0
2: 1
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116606738 Original CRISPR TTCTGCCAACACTACCTGTT AGG (reversed) Intronic
900749286 1:4384259-4384281 CTCTGCCAACACTCAATGTTGGG + Intergenic
901903758 1:12390535-12390557 TTCTGCCAAGACTACCTCTGTGG - Intronic
905787504 1:40770023-40770045 TTCTGCCAGCACCACATGCTAGG + Intronic
908011633 1:59784518-59784540 TTCTGCCAATACTAATTGATTGG + Intergenic
914772024 1:150696165-150696187 GTCTGGCAACACTACTTATTAGG - Intronic
916047197 1:161008939-161008961 TTCTTCCAGCACTTCCTGGTGGG - Intronic
916108289 1:161446457-161446479 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916109875 1:161453837-161453859 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916111462 1:161461248-161461270 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916113048 1:161468628-161468650 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916116481 1:161489069-161489091 ATCTGTCATCTCTACCTGTTGGG + Intergenic
918671768 1:187225827-187225849 TTCTTCTAACACTACATCTTTGG + Intergenic
922771078 1:228183305-228183327 TTCTGCAAAGACTCACTGTTAGG - Intergenic
923105318 1:230849687-230849709 GGCTGCCAAAACTAACTGTTTGG + Intronic
1069207132 10:65704606-65704628 TTCATCTAACAATACCTGTTGGG + Intergenic
1078266616 11:9759682-9759704 TACGCCCAACACTAACTGTTTGG + Intergenic
1081283829 11:41244936-41244958 TTTTGCCTACATCACCTGTTAGG + Intronic
1085318928 11:75562598-75562620 ATCTGCCACCACCACCTTTTAGG - Exonic
1085794863 11:79529946-79529968 CCCTGCCAACACTACCTCCTTGG + Intergenic
1086004456 11:82021309-82021331 ATGTGCCAAAGCTACCTGTTGGG + Intergenic
1088407455 11:109497555-109497577 TTCTGCCAAGACTACCATCTGGG - Intergenic
1094691330 12:32772279-32772301 TTCTGCAAACTTTACCTGCTGGG - Intergenic
1095779559 12:46044376-46044398 CTTTGCCAACACTCCCTGTGTGG - Intergenic
1097999765 12:65927398-65927420 TTCTGCCTCCACTAGATGTTTGG + Intronic
1098719585 12:73879990-73880012 TCCTGCCAAATCTACCTCTTCGG - Intergenic
1099854678 12:88148855-88148877 TTAAGCCAAAACTACCTATTGGG - Intronic
1102004708 12:109581715-109581737 CTCTGCCAGCACTAGCTGTGTGG - Intronic
1102406037 12:112675034-112675056 TTCTGCAAAGGCTGCCTGTTTGG - Intronic
1107058147 13:36129078-36129100 TTCTCCCAACACTAGGAGTTTGG + Intronic
1107190667 13:37581026-37581048 TTTGGCCAACACTATCTGTAAGG + Intronic
1109304914 13:60627665-60627687 TTCTGCAAGCACTACCTGTTAGG - Intergenic
1109660349 13:65450695-65450717 TAATGCCAACTATACCTGTTTGG + Intergenic
1111100052 13:83571812-83571834 TCCTGACAACAATTCCTGTTTGG - Intergenic
1111313786 13:86524371-86524393 TTCTTTCAACATTACCTGTATGG + Intergenic
1111994862 13:95155742-95155764 TTCTACCAACACCAGCTCTTGGG + Intronic
1114791250 14:25660979-25661001 TTTTGGCAACAATACCTGTGAGG + Intergenic
1116606738 14:47008313-47008335 TTCTGCCAACACTACCTGTTAGG - Intronic
1120455861 14:84729692-84729714 GTCTGCCAACACTATTTGTAAGG - Intergenic
1126859640 15:52871365-52871387 CCCTGCCAACACCACATGTTTGG + Intergenic
1126952947 15:53902436-53902458 TTCTGCAATCACTAACTGATAGG - Intergenic
1126978496 15:54213827-54213849 TTCCAGCAATACTACCTGTTAGG - Intronic
1127960599 15:63887713-63887735 TTCTGCCAACACTTCCTCTGAGG + Intergenic
1131974340 15:97928841-97928863 TTCTGCAAACAATACGAGTTTGG + Intergenic
1139257655 16:65558342-65558364 TTCTACCACCACTACTTCTTAGG + Intergenic
1142760337 17:2038370-2038392 TTCTGCCCAAACTAGCTCTTGGG - Intronic
1155603405 18:27575363-27575385 CTCTGACAACACTCCCTCTTAGG - Intergenic
1156703950 18:39857399-39857421 TTCTGCTAACTCTCTCTGTTTGG - Intergenic
1158068052 18:53437271-53437293 TGCTTCCTAAACTACCTGTTGGG - Intronic
1159364887 18:67452826-67452848 TTCTGAGAACTTTACCTGTTAGG - Intergenic
1160565913 18:79786489-79786511 TTCTGGCAAAACTACCTGGCTGG - Intergenic
1161954936 19:7488474-7488496 TTCTGCCAACCCAACCTGTCTGG - Intronic
1164877394 19:31701069-31701091 ACCTGCCAACACTATCTTTTTGG - Intergenic
925410178 2:3635264-3635286 TTCTGCCAACACTGCCTCCTGGG + Intronic
925917257 2:8615546-8615568 TTCTGCCATCTCTCTCTGTTTGG - Intergenic
930584342 2:53251910-53251932 TTCTCACCACACTACATGTTTGG - Intergenic
931443116 2:62305209-62305231 CTCTGCAAACACCACCTGCTGGG + Intergenic
941130634 2:161645713-161645735 TTCAGCCAACACTAAATTTTTGG - Intronic
941572042 2:167182582-167182604 TTCTGCTGACTCTACATGTTTGG - Intronic
942452950 2:176120007-176120029 TTCTGGTTACACTCCCTGTTTGG + Intergenic
944170458 2:196771015-196771037 ATCTGGCAACACCACCTTTTAGG + Intronic
945734604 2:213584121-213584143 TTTGGCCAATACTACATGTTAGG - Intronic
945800027 2:214417400-214417422 TTCTGCCATCACAATCTCTTGGG - Intronic
946312354 2:218889793-218889815 TTCTGCAAACAGAACCTGGTGGG - Intronic
1168900288 20:1358208-1358230 TTCTGCCCACACTCTCTGTGAGG + Intronic
1170174404 20:13452980-13453002 TTTTCCCAGCACTGCCTGTTAGG - Intronic
1174075028 20:47928785-47928807 TACTGCAAACACTATCTGATTGG + Intergenic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1176970867 21:15264062-15264084 TTCTGCCAACAAAAACTGCTTGG - Intergenic
1183264458 22:36816822-36816844 TTCTGCCCACACTTCCCGCTGGG - Intronic
951354330 3:21645705-21645727 TCCTGCCAACAGTCCCTGTGTGG + Intronic
955254337 3:57314385-57314407 TTCTCCCAACACTAACAGGTGGG - Intronic
955362057 3:58284153-58284175 TCCAGCCACCACTACCTCTTTGG + Intronic
955860676 3:63326424-63326446 TTCTTCCATCACCAGCTGTTAGG + Intronic
956662372 3:71611833-71611855 TTCTGCCACCATTAGCTGTGAGG + Intergenic
957427167 3:80052573-80052595 TTCAGCTCACACTACCAGTTTGG - Intergenic
960980329 3:123218192-123218214 TTCTGCCAGTCTTACCTGTTAGG + Intronic
962450915 3:135516280-135516302 TCCTGCCAGCACCACCTCTTGGG - Intergenic
969080399 4:4613334-4613356 TTCTGCCACCACTAACAGTGTGG - Intergenic
976005081 4:80420065-80420087 TTCTGCCACCATAACCTGCTTGG - Intronic
976523438 4:86058062-86058084 TTCTGCCAAGACTATCAGGTTGG + Intronic
976619739 4:87115440-87115462 TTCTTCCAGCATTACCTGTCTGG + Intronic
977375706 4:96201232-96201254 TTCTGAAAACATTACTTGTTGGG + Intergenic
978094626 4:104761158-104761180 TGCTGCCAACACAACCTGGAAGG + Intergenic
978622219 4:110644067-110644089 TTATGCCAACACTACAAGGTAGG + Intergenic
979274180 4:118796521-118796543 TGCTGCCAACACTTCCTTTTGGG - Intronic
979799467 4:124890251-124890273 TTCTCCAAATGCTACCTGTTAGG + Intergenic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
982167829 4:152631202-152631224 TTCTTCCAACACTACTCTTTAGG + Intronic
982236690 4:153257644-153257666 TTCTGCTAACACTTCAAGTTGGG - Intronic
983177190 4:164603836-164603858 ATCTGGCAACCCTACTTGTTTGG - Intergenic
983689038 4:170445796-170445818 ATCTGCCACCACTACTAGTTGGG - Intergenic
985892517 5:2726612-2726634 TTCTGCCTACTCTACCTGGAAGG - Intergenic
986684774 5:10267112-10267134 TTCTGCCAAGACTGCCTGCAAGG - Intergenic
991096607 5:62746497-62746519 TTCTCCCCACCCTACCTTTTTGG + Intergenic
993863026 5:93159178-93159200 TGCTGCAAACACTTCTTGTTAGG + Intergenic
994566646 5:101455196-101455218 TCCTGCCAACACTACTAGGTAGG + Intergenic
997380440 5:133432467-133432489 TTCTGCCAAACCTACCTTGTGGG + Intronic
997936058 5:138112202-138112224 GTCTTCCAACATAACCTGTTAGG - Intergenic
998136653 5:139677630-139677652 TTCTGCCTGCAGCACCTGTTTGG + Intronic
1004466995 6:15895183-15895205 TCCTGCCACCAAAACCTGTTTGG + Intergenic
1004849727 6:19686512-19686534 TTCTGACAACACAATGTGTTAGG + Intergenic
1007366796 6:41399760-41399782 TCCTGCCAACACTCCCTGTGAGG + Intergenic
1008535230 6:52502363-52502385 TTCTGCCACCATTACCTTTCTGG + Exonic
1010844002 6:80682180-80682202 TTTTGGTAAGACTACCTGTTTGG + Intergenic
1012040377 6:94197439-94197461 TTTTGCCACCACTACCACTTAGG - Intergenic
1014643473 6:123944235-123944257 TTCTGCCATCCCAACCTGGTAGG + Intronic
1020071674 7:5231188-5231210 TTTTGCCAAAATTAACTGTTTGG + Exonic
1020497203 7:8870768-8870790 TTTTGCCAATTCTACCTTTTGGG - Intergenic
1021555995 7:21918688-21918710 TTTTGCCAAGACTACTTTTTAGG + Intronic
1022494216 7:30843204-30843226 TTCTGCCTCCCCTCCCTGTTTGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023857104 7:44190709-44190731 TTCTGCCAACACGAGAAGTTTGG + Intronic
1024305842 7:47929125-47929147 TTTTCCCAACACTGCCTCTTGGG + Intronic
1025263078 7:57434692-57434714 CTCTTCCAACACTATCTTTTTGG + Intergenic
1026240258 7:68567683-68567705 AGCTGCCAACACTACCAGCTGGG - Intergenic
1026567170 7:71498981-71499003 TTGTGCCAACTCCACCTGTAAGG + Intronic
1027862848 7:83607039-83607061 TTGTACCAACACTTCCTGTTTGG + Intronic
1028163216 7:87509117-87509139 ATCTGGCCACACTTCCTGTTTGG - Intronic
1030861390 7:114635192-114635214 TTCAGCCAAAATTAGCTGTTTGG + Intronic
1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG + Intronic
1043130272 8:76451145-76451167 TTTTGTCAACACTACTTCTTAGG + Intergenic
1043522564 8:81062307-81062329 TTCTGCAAACATAACCTGTTTGG + Intronic
1044800173 8:95945608-95945630 TTCTGGTAAAACTACCTCTTAGG + Intergenic
1047333783 8:123917215-123917237 ATCAGTCAACACTTCCTGTTTGG - Intronic
1050187974 9:2995325-2995347 TTCTGCCAATGCTACCTACTTGG - Intergenic
1051009403 9:12392922-12392944 TCCTCCCAACAATATCTGTTTGG - Intergenic
1052387651 9:27840612-27840634 TTCTGCCAAAAATACCTGACAGG - Intergenic
1052796175 9:32925553-32925575 TTCGGCCAAGACTACATGCTTGG + Intergenic
1053383118 9:37665441-37665463 TTCTGAAAACACCACCTGTCTGG - Intronic
1056721671 9:89077281-89077303 TTATGCCCACAGTACCTGTATGG + Intronic
1057275695 9:93675015-93675037 CTGTCCCAGCACTACCTGTTGGG - Exonic
1057294552 9:93827662-93827684 TTCTGCCAGCACAGCCTGTGGGG + Intergenic
1057818697 9:98315005-98315027 TTCTGTGAAAACTACCTGATGGG - Intronic
1058406550 9:104682865-104682887 TACTGCCCTCACTAACTGTTGGG + Intergenic
1061274111 9:129559533-129559555 TTATGCTAACCCTCCCTGTTGGG + Intergenic
1061939392 9:133875935-133875957 GTCTGCCATCATGACCTGTTTGG - Intronic
1193439530 X:81521753-81521775 TTCTGCCAACAATGTCTCTTGGG - Intergenic
1193944512 X:87717855-87717877 TTATGCCAACATTACTTGCTGGG + Intergenic
1194155223 X:90379852-90379874 TTTTGCCAAAACTACCATTTGGG - Intergenic
1197935345 X:131734726-131734748 TTCTCTGAGCACTACCTGTTGGG - Intergenic
1200501573 Y:3956785-3956807 TTTTGCCAAAACTACCATTTGGG - Intergenic
1202098718 Y:21282278-21282300 CTCTGCCAACAATAGCTCTTTGG - Intergenic
1202172034 Y:22060234-22060256 TTCTACCCACACTACCTGGCAGG + Intergenic
1202219328 Y:22526137-22526159 TTCTACCCACACTACCTGGCAGG - Intergenic
1202323852 Y:23669928-23669950 TTCTACCCACACTACCTGGCAGG + Intergenic
1202546919 Y:26000126-26000148 TTCTACCCACACTACCTGGCAGG - Intergenic