ID: 1116609515

View in Genome Browser
Species Human (GRCh38)
Location 14:47049719-47049741
Sequence CATTCTATGCAGAATATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116609515_1116609517 22 Left 1116609515 14:47049719-47049741 CCTTTCATATTCTGCATAGAATG 0: 1
1: 0
2: 0
3: 27
4: 403
Right 1116609517 14:47049764-47049786 CTTCTCTTTTCACATATTTTTGG 0: 1
1: 0
2: 6
3: 48
4: 636
1116609515_1116609516 -5 Left 1116609515 14:47049719-47049741 CCTTTCATATTCTGCATAGAATG 0: 1
1: 0
2: 0
3: 27
4: 403
Right 1116609516 14:47049737-47049759 GAATGTTTTCAAAAGTGCAGTGG 0: 1
1: 0
2: 1
3: 17
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116609515 Original CRISPR CATTCTATGCAGAATATGAA AGG (reversed) Intronic
904197373 1:28795833-28795855 AAGTCTAAGGAGAATATGAATGG - Intergenic
904617066 1:31755637-31755659 CATTCTAGGCAGAGCAAGAAGGG - Intronic
905962411 1:42054799-42054821 AATTCTATGAAGAATGTCAATGG + Intergenic
906582965 1:46951750-46951772 AATACTATGTTGAATATGAATGG - Intergenic
907928020 1:58972954-58972976 CATTCTCTGAAGCATGTGAATGG + Intergenic
908708437 1:66988350-66988372 CATCCTTTGCAGAATCTTAAAGG + Intronic
909440712 1:75692504-75692526 GATTCTATGCAGAAGTAGAAGGG + Intergenic
909518428 1:76538982-76539004 CATTCGATGAAGAACATCAATGG - Intronic
911222914 1:95269425-95269447 CGCTCTATGCAGTATATGGATGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
911713364 1:101100113-101100135 CATTAGATTCAGAATCTGAATGG - Intergenic
911794881 1:102063041-102063063 AATTCTGTGAAGAATGTGAATGG - Intergenic
912389179 1:109290116-109290138 CCTTCAATGCAGAATATGGCTGG + Intergenic
917046716 1:170868711-170868733 AATTCTATGAAGAATGTCAATGG + Intergenic
917079468 1:171241938-171241960 AATTCTGTGAAGAATATCAATGG - Intergenic
917151199 1:171946755-171946777 CATTCATGGCAGAAAATGAAGGG + Intronic
918948486 1:191102573-191102595 TAATCTATGCAGAACAAGAAAGG - Intergenic
918951170 1:191141083-191141105 AATACTATGCTGAGTATGAATGG + Intergenic
919164708 1:193877300-193877322 AATTCTGTGAAGAATATCAATGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
920590866 1:207217264-207217286 CATTCTCTGCAGAATGTCACAGG + Intergenic
921113871 1:212067878-212067900 AAATATATGCAGAATATTAAAGG + Intronic
921433633 1:215091228-215091250 CATTCTAAGCAGAATGGGCATGG + Intronic
921736003 1:218629324-218629346 AATTCTGTGAAGAATATCAATGG + Intergenic
921899221 1:220432745-220432767 CATTCTGTGCACAATTTGCAAGG - Intergenic
922138593 1:222857896-222857918 AATTCTGTGAAGAATATCAATGG - Intergenic
922380427 1:225018087-225018109 CATTTAATTCAGAATCTGAATGG + Intronic
922703371 1:227775253-227775275 CATTCTCTGCAGCATATTAATGG + Intronic
924868250 1:248010128-248010150 AATACTATGCAGAATAGGAGTGG - Intronic
924871732 1:248054468-248054490 AATTCTGTGAAGAATATCAATGG + Intronic
1064278444 10:13929248-13929270 CATTCCATGCAGAAAGAGAATGG - Intronic
1064395289 10:14976775-14976797 AATATTATGAAGAATATGAAAGG - Intronic
1064734335 10:18365300-18365322 CATTCTCATCAGAATATGAGAGG + Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065686963 10:28295166-28295188 CATACTAAGCATAATGTGAAAGG + Intronic
1066087707 10:31987128-31987150 AATTCTGTGAAGAATATTAATGG - Intergenic
1066685669 10:37979104-37979126 CAATCTATTCAGAATTAGAAGGG - Intergenic
1067086956 10:43247328-43247350 CAATCTATTCAGAAAATGATCGG + Intronic
1067207056 10:44227465-44227487 AATTCTGTGAAGAATATCAATGG + Intergenic
1067236611 10:44456077-44456099 AATTCTATGAAGAATGTCAATGG + Intergenic
1067580966 10:47445315-47445337 CATTCATGGCAGAAGATGAAGGG - Intergenic
1067732987 10:48826493-48826515 AATTCTGTGAAGAATATCAATGG + Intronic
1067929713 10:50548176-50548198 AGTTCTATGAAGAATATCAATGG - Intronic
1068611650 10:59066951-59066973 CACTCTATGAAGAATTTGGAGGG - Intergenic
1071913643 10:90265354-90265376 AATTCTATGAAGAATGTCAATGG - Intergenic
1073152268 10:101320207-101320229 CATTCTAATCAGAAGATAAAAGG + Intergenic
1073717024 10:106119237-106119259 AATTCTATGAAGAATGTCAATGG - Intergenic
1073910177 10:108332874-108332896 AATTCTATGAAGAATATTAATGG + Intergenic
1074594671 10:114850775-114850797 TCTACTATGCAGAATATGTAAGG - Intronic
1075105793 10:119539189-119539211 CTTTCTCTGCAGAATATCACTGG - Intronic
1075185662 10:120254315-120254337 GATTATGTGCAGAATATGATTGG + Intergenic
1075322508 10:121503383-121503405 AATTAGATGCAGAATATAAATGG - Intronic
1077953930 11:6992445-6992467 CATGCTATGAATAATATGACAGG + Intergenic
1077956997 11:7031315-7031337 CATTCTGTGTGGAAAATGAAAGG + Intronic
1078392461 11:10947790-10947812 AATTCTATGCAGAAAGTCAATGG + Intergenic
1078463676 11:11534338-11534360 CATGGTAGGCATAATATGAAAGG + Intronic
1079261176 11:18882928-18882950 AATTCTGTGAAGAATGTGAATGG - Intergenic
1079705732 11:23615463-23615485 AATTCTATGAAGAATGTCAATGG + Intergenic
1080238133 11:30095770-30095792 AATTCTATGAAGAACATTAATGG + Intergenic
1080523622 11:33090619-33090641 CATTCAAAGAAGAGTATGAAGGG - Exonic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1082223662 11:49674435-49674457 CATTCTATGTTGAATATGATTGG + Intergenic
1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG + Intergenic
1085005313 11:73083074-73083096 CATTCTCTGCAGTTTATGAAAGG - Intronic
1086418500 11:86613934-86613956 AATTCTAGGAAGAATATCAATGG - Intronic
1087274462 11:96146929-96146951 CACTCTTTGCTGAAAATGAAAGG + Intronic
1087442434 11:98203493-98203515 CATTCTGTGAAGAATGTCAATGG - Intergenic
1087642427 11:100769627-100769649 CAGTTTATGCAGAATATTATTGG + Intronic
1088513615 11:110602851-110602873 TATTCTATGCAGACTATTCAAGG - Intronic
1089763328 11:120744737-120744759 AGTTCTATGTAGAATATTAATGG + Intronic
1090109612 11:123892054-123892076 CACTCTGAGCAGAAAATGAAAGG - Intergenic
1090486120 11:127113615-127113637 AGTTCTATGCAGATTTTGAAAGG - Intergenic
1090895698 11:130972780-130972802 AATTCTATGTTGAATAAGAATGG + Intergenic
1092325163 12:7523411-7523433 AATTCTGTGAAGAATATCAATGG + Intergenic
1092456439 12:8647787-8647809 CATTCTATGTACAATTTCAAGGG - Exonic
1092747170 12:11684369-11684391 CTTTCTAAGCAAAATATTAAAGG - Intronic
1092758036 12:11783298-11783320 AATTCTATGCAGCATCTGATTGG - Intronic
1094290180 12:28839613-28839635 AATTCTATGAAGAATATCATTGG - Intergenic
1095320003 12:40815678-40815700 AATTCTATGTTGAATAGGAATGG + Intronic
1095398274 12:41786132-41786154 GATACTCTGCAGAATGTGAAAGG - Intergenic
1096034364 12:48451950-48451972 AATTCTGTGAAGAATATCAATGG - Intergenic
1096051252 12:48610509-48610531 AATTCTATGAAGAATCTCAATGG + Intergenic
1096243866 12:49973744-49973766 CAGTCTAGGCAGAATAGAAATGG + Intronic
1097499166 12:60380175-60380197 AATTCTTTGAAGAATATCAATGG - Intergenic
1098552000 12:71772913-71772935 CATTCTGTAGAGAATAGGAATGG + Intronic
1098637012 12:72796814-72796836 AATTCTGTGAAGAATATCAATGG + Intergenic
1099486767 12:83238450-83238472 AATTCTATGAAGAATGTCAATGG + Intergenic
1100950593 12:99844761-99844783 AATTCTATGAAGAATGTCAATGG + Intronic
1101699257 12:107156352-107156374 TATTGGATGCAGAGTATGAAAGG + Intergenic
1102723636 12:115039210-115039232 CATTCTCTGCAGAGTGTCAAGGG + Intergenic
1104116794 12:125757226-125757248 CATCGTATGAAGAACATGAAAGG - Intergenic
1106388161 13:29308048-29308070 CATTCTGTGAAGAATGTCAATGG - Intronic
1108580587 13:51825011-51825033 CATTCTATGCAAAATCTGTAAGG - Intergenic
1109403609 13:61868665-61868687 AATGCTATGCAGAATGTCAATGG + Intergenic
1110010545 13:70327487-70327509 CATTCTGTGAAGAATGTGAATGG + Intergenic
1110102729 13:71630104-71630126 TATTCTGGGCAGCATATGAAAGG + Intronic
1110374193 13:74774000-74774022 TATAGTATGAAGAATATGAAGGG + Intergenic
1110661987 13:78067279-78067301 CATTCTATTTAGAATCTGGATGG + Intergenic
1110888419 13:80668466-80668488 CATTCTAAACACAAAATGAAAGG + Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1116193159 14:41685991-41686013 AATTCTGTGAAGAATATCAATGG + Intronic
1116272807 14:42794384-42794406 CATCCTATGCACCAAATGAAAGG + Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1117079265 14:52134601-52134623 AATTCTGTGCAGAATGTCAATGG - Intergenic
1118225610 14:63896314-63896336 CTTACTATGCAGGATATGATAGG - Intronic
1118644904 14:67829009-67829031 AATTCTGTGAAGAATGTGAATGG + Intronic
1120794172 14:88613732-88613754 CATTTTATACATAAAATGAATGG + Exonic
1123163763 14:106306295-106306317 CAGTCAAGGCAGAAGATGAAGGG + Intergenic
1125127737 15:36243937-36243959 AATTCTATGAAGAATGTCAATGG - Intergenic
1126784749 15:52168583-52168605 TATTCTATGAAGAATGTCAATGG - Intronic
1131389886 15:92038718-92038740 AATTCTATGAAGAATATCCATGG - Intronic
1133563061 16:6967519-6967541 CAGTCTATTCAGCAAATGAAAGG - Intronic
1137770642 16:51013566-51013588 CATTTTGTGCAGAATAAGTAAGG + Intergenic
1138832158 16:60387562-60387584 CATTCTGTGAAGAATGTCAATGG + Intergenic
1139020770 16:62746204-62746226 TTTTCCATGCAGAATATCAATGG - Intergenic
1139042628 16:63016388-63016410 AATTCTGTGCAGAATGTCAATGG + Intergenic
1140319449 16:73934605-73934627 CATTCTGTGAAGAATGTCAATGG - Intergenic
1140669687 16:77265288-77265310 AATTCTGTGAAGAATATCAATGG + Intronic
1141327168 16:83071854-83071876 TAATCTATGCATAATATAAATGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144532911 17:16057351-16057373 CATTCTAAGAATAATATGCAGGG + Intronic
1144562704 17:16334802-16334824 AATTCTAGTCAGAATATCAATGG + Intronic
1153341718 18:3981670-3981692 CAAGCCATGCAGAATCTGAAGGG - Intronic
1153863482 18:9238061-9238083 AATTCTATGGAGAATTTCAAAGG - Intronic
1155754508 18:29473717-29473739 AATTCTGTGAAGAATATCAATGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1156289812 18:35737006-35737028 AATACTATGTCGAATATGAATGG - Intergenic
1156824347 18:41412463-41412485 CATTCTGTGAAGAATGTCAATGG - Intergenic
1157086163 18:44582085-44582107 CATCCTGGGCAGAATATGAGTGG + Intergenic
1158033583 18:52997266-52997288 AATTCTAAGTAGAATATGAAGGG - Intronic
1158921207 18:62192907-62192929 AATTCTATGAAGAATGTCAATGG + Intronic
1159063806 18:63545712-63545734 CATCCTGTTCTGAATATGAATGG + Intergenic
1159632733 18:70767620-70767642 CATTCTGTGAAGAATGTGAATGG - Intergenic
1159660516 18:71090409-71090431 AATTCTATGAAGAAAATCAATGG + Intergenic
1160253181 18:77221918-77221940 CAGTCTATGCAAAATCTGGAAGG + Intergenic
1162257138 19:9499620-9499642 TATTCTGTGCAGAAAAAGAAAGG + Intergenic
1164163353 19:22646046-22646068 AATTCTGTGAAGAATGTGAATGG + Intronic
1164538935 19:29107814-29107836 CAATACATGCAGAATATGCAAGG - Intergenic
1165458119 19:35926743-35926765 CATGCCATGCAGAGAATGAAAGG + Intergenic
925323182 2:2992880-2992902 CATTTTCTGGAGAATTTGAATGG + Intergenic
926993356 2:18704766-18704788 TATTCTATGCAGAATGTAAATGG + Intergenic
927568022 2:24131353-24131375 AATTCTATGAAGAATGTCAATGG + Intronic
928015765 2:27655570-27655592 AACTCTCTGAAGAATATGAAAGG - Exonic
928354443 2:30597168-30597190 AATTCTATGAAGAATGTCAACGG + Intronic
928355176 2:30606205-30606227 AATTCTATGAAGAATGTCAACGG - Intronic
928475308 2:31620299-31620321 AATACTATGCTGAATAGGAATGG - Intergenic
932523058 2:72433932-72433954 AATACTATGCTGAATAGGAATGG + Intronic
932744119 2:74317576-74317598 CTTTCTACTCAGAATATGGAGGG + Intronic
932914306 2:75838585-75838607 AATTCTATGAAGAAAATCAATGG - Intergenic
932941592 2:76173061-76173083 CATTCTGTGAAGAATGTCAATGG + Intergenic
933782991 2:85814643-85814665 CATTTTATGCAAAATATAACAGG + Intergenic
934019376 2:87929591-87929613 AGTTCTGTGAAGAATATGAATGG + Intergenic
935376628 2:102406424-102406446 CATTCTCTATGGAATATGAATGG - Intergenic
935567541 2:104625258-104625280 AATTCTATGAAGAAAATCAATGG + Intergenic
936877569 2:117210385-117210407 AATTCTATGAAGAATGTCAATGG - Intergenic
937503306 2:122507539-122507561 CATTTTATTAAAAATATGAAAGG + Intergenic
939753178 2:146074428-146074450 CATTCTAAGCAAACTATCAAAGG - Intergenic
940393047 2:153154759-153154781 AATTCTATGTTGAATAGGAATGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941543223 2:166813240-166813262 AATACTATTCAGAAAATGAACGG - Intergenic
941743295 2:169059528-169059550 AGTTCTATGAAGAATATTAATGG - Intergenic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
942635518 2:178000028-178000050 TAGAGTATGCAGAATATGAAAGG + Intronic
942899142 2:181093334-181093356 CATACTATGCTGAATAGGAGTGG - Intergenic
943438990 2:187902529-187902551 AATTCTGTGCAGAATGTCAATGG - Intergenic
943696238 2:190936406-190936428 CATCATTTTCAGAATATGAATGG - Intronic
944035942 2:195294706-195294728 AATTCTATGAAGAATGTCAATGG - Intergenic
944070749 2:195665693-195665715 CTCTCTAGGCAGAATATGAAAGG - Intronic
944407060 2:199396821-199396843 CATTTTATGCAGATTAGGTATGG - Intronic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
944925662 2:204461454-204461476 AATTCTATGCTGAATAGGAGTGG + Intergenic
945455160 2:210043525-210043547 AATTCAATGCAGATTATAAATGG + Intronic
945605485 2:211924628-211924650 CATTCTACACAGAATAAAAAAGG + Intronic
946785830 2:223243033-223243055 AATTCTATGAAGAATATCAATGG + Intergenic
1170011863 20:11732653-11732675 AATTCTATGAAGAATGTCAATGG - Intergenic
1170492539 20:16893223-16893245 AATTCTATGAAGAATGTCAATGG - Intergenic
1171285432 20:23933832-23933854 CTATCTATGCAGAATAGCAAAGG + Intergenic
1171535796 20:25887872-25887894 AATTCTATGCTGAATAGGAGTGG - Intergenic
1171937687 20:31291243-31291265 AATTCTATGAAGAATGTCAATGG - Intergenic
1173314923 20:41934308-41934330 CATTCTATGCGCAGTATGAAGGG - Intergenic
1174099845 20:48119016-48119038 CATTCTATGAAGAGCATGCAGGG + Intergenic
1174148184 20:48467208-48467230 CATTCTATGAAGAGCATGGAGGG + Intergenic
1177133572 21:17286330-17286352 AATTCTCTGAAGAATATCAATGG - Intergenic
1177351815 21:19952743-19952765 AATTCTATGAAGAAAATCAATGG + Intergenic
1177455988 21:21340310-21340332 CATTCTCTGCATAATATATAAGG - Intronic
1177967178 21:27742411-27742433 CAATTTATGCAGAATATCATTGG + Intergenic
1178270334 21:31183587-31183609 CATTTTCTGCAGAATCTGAGTGG - Intronic
1179950779 21:44707796-44707818 CATTCATTTCAGAACATGAATGG + Intronic
1180107254 21:45627863-45627885 AATTCTGTGAAGAATATCAATGG + Intergenic
1181421566 22:22802920-22802942 CAACCTGTGGAGAATATGAAGGG - Intronic
1182572779 22:31251056-31251078 CATTCTCTGCTGAGTATGTATGG - Intronic
1182950195 22:34367197-34367219 TATTCTGTGAAGAATATCAATGG + Intergenic
1183043624 22:35202225-35202247 CATTCATGGCAGAATAGGAAGGG - Intergenic
951180803 3:19655945-19655967 CAATCATTGCAGAAGATGAAGGG + Intergenic
951560910 3:23965833-23965855 TATTCGATACAGAATAAGAAGGG + Intronic
952365414 3:32670468-32670490 AATTCTATGAAGACTAAGAAAGG - Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
952503316 3:33984713-33984735 AATTCTATGAGGAATATCAATGG + Intergenic
954425421 3:50440519-50440541 CATTCTGTACTGGATATGAAGGG - Intronic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957451257 3:80385502-80385524 TATTCTATTCAGACTCTGAAAGG + Intergenic
957856899 3:85891171-85891193 CTTGCTATGCAGAAGATTAAAGG - Intronic
958142789 3:89584791-89584813 CACTGTATGCAAAATATAAATGG + Intergenic
958448439 3:94243518-94243540 AATTCAATGCTGCATATGAAAGG + Intergenic
958617916 3:96519689-96519711 ATTTCTATGCAGAATATCATTGG - Intergenic
959205420 3:103300710-103300732 AATTCTATGAAGAATGTCAATGG + Intergenic
959589057 3:108055920-108055942 CATTCTATGCTAGATATGGAAGG + Intronic
959917959 3:111839258-111839280 CATTCTATAAAGAATATTATTGG + Intronic
960170841 3:114459121-114459143 TATTATGTGCAGAATATGCATGG - Intronic
960745276 3:120881012-120881034 AATTCTGTGAAGAATATCAATGG - Intergenic
962537277 3:136341302-136341324 TATGCTATGCAGCATAGGAAAGG - Intronic
962972208 3:140412411-140412433 CAGTCCATGCAGAGTATGAGGGG + Intronic
963828399 3:149981321-149981343 CACTCTCTGCAAAAAATGAAAGG + Intronic
965554359 3:170004314-170004336 CATTTTGTGGAAAATATGAAGGG + Intergenic
965835242 3:172843854-172843876 CAGTATAAGGAGAATATGAAAGG - Intergenic
965983013 3:174715916-174715938 TATTTTTTGTAGAATATGAATGG + Intronic
966080653 3:175995956-175995978 AATTCTATGAAGAATAACAATGG + Intergenic
967242003 3:187448692-187448714 CATTCCATGCAGCCTATCAAGGG - Intergenic
967767449 3:193296712-193296734 AATTCTGTGAAGAATATTAATGG + Intronic
967790383 3:193542438-193542460 AATTCTATGAAGAATGTCAATGG - Intronic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
971270212 4:25136679-25136701 AATTCTATGAAGAATGTCAACGG - Intronic
971517056 4:27500419-27500441 AATTCTATGAAGAATGTCAATGG - Intergenic
971772023 4:30909293-30909315 GATTCTATGTTGAATAGGAATGG - Intronic
972022212 4:34329820-34329842 TTTTCTATGAAGAATATCAATGG - Intergenic
972190977 4:36590197-36590219 AATTCTATGAAGAATGTCAATGG + Intergenic
972759413 4:42088556-42088578 CATTCATGGCAGAATACGAAGGG + Exonic
972984949 4:44751951-44751973 AATTCTGTGAAGAATATCAATGG + Intergenic
973299892 4:48569697-48569719 CATTCAATGCTACATATGAAAGG + Intronic
974217865 4:58922704-58922726 TATTCTATGTAGAATATATATGG + Intergenic
974498599 4:62666649-62666671 AATTCTGTGCAGAATGTCAATGG - Intergenic
974912834 4:68144430-68144452 AATTCTGTGAAGAATATCAATGG + Intergenic
975107540 4:70584983-70585005 CATTTTATGTAACATATGAATGG - Intergenic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
975902492 4:79169221-79169243 AATTCTATGAAGAAAATCAATGG - Intergenic
975929540 4:79502270-79502292 CATACTATGCTGAATAAGAGTGG - Intergenic
976385462 4:84452497-84452519 CATGCAATGCATAATATGCAGGG - Intergenic
976517878 4:85992160-85992182 CATTCTAAGAAGAAAATGACAGG + Intronic
977440664 4:97063128-97063150 CATTCACTGCAGAACATGAAGGG + Intergenic
977462402 4:97341476-97341498 AATTCTCTGAAGAATATCAATGG - Intronic
977614019 4:99067117-99067139 TATTCTATACAGAATGTGACTGG + Intergenic
978156372 4:105493623-105493645 AATTCTGTGAAGAATATCAATGG + Intergenic
979958332 4:126983884-126983906 AATTCCATGGAGAATATCAATGG - Intergenic
980021717 4:127718509-127718531 AATTCTATGAAGAATATCAATGG + Exonic
980387492 4:132105205-132105227 AATACTATGCTGAATAGGAATGG - Intergenic
980507895 4:133746603-133746625 CATTCTGTGAAGAATGTCAATGG - Intergenic
980573664 4:134657779-134657801 CATTCTGTGAAGAATGTCAATGG + Intergenic
981721422 4:147805495-147805517 AATTCTATGAAGAATGTCAATGG + Intronic
982382412 4:154763239-154763261 AATACTGTTCAGAATATGAAGGG - Intergenic
982682971 4:158454434-158454456 TATTCTATGAAGAATATCATTGG + Intronic
982852153 4:160331937-160331959 CATAATATGCACAATATCAAGGG + Intergenic
983169238 4:164517122-164517144 TATTCTATGAAGAATGTAAATGG + Intergenic
983402701 4:167285487-167285509 AATTCTATGAAGAATGTGAATGG + Intergenic
983746727 4:171209866-171209888 AATTCTTTGAAGAATATCAATGG + Intergenic
984324515 4:178235071-178235093 AATTCTGTGCAGAATATCAATGG + Intergenic
984360554 4:178725158-178725180 AATTCTGTGGAGAATATCAATGG + Intergenic
984628113 4:182031577-182031599 AATTCTGTGAAGAATATCAATGG + Intergenic
985025374 4:185734658-185734680 CATCCTATGCAGAGTTGGAAAGG - Intronic
986069869 5:4271165-4271187 CAGTTTGTGCAGGATATGAATGG + Intergenic
986210093 5:5663903-5663925 CTTTCAATGCAGGATATGAGTGG - Intergenic
986486259 5:8241517-8241539 CATTCCATGCAACATATGCATGG + Intergenic
986956096 5:13151707-13151729 AATTCTATGAAGAATGTCAATGG + Intergenic
987753531 5:22070727-22070749 CATTCTGTGAAGAATGTCAATGG + Intronic
987909735 5:24125823-24125845 AATTCTATGAAGAATGTCAATGG + Intronic
987988118 5:25176615-25176637 AATTCTATGAAGAATGTCAATGG + Intergenic
988054462 5:26075926-26075948 CATTCTATGATGAATATCAGTGG - Intergenic
988179260 5:27767905-27767927 CATACTAAGCAGAATCAGAAAGG - Intergenic
988362293 5:30252364-30252386 CATACTATGTTGAATAGGAATGG + Intergenic
990525911 5:56627705-56627727 CATTCTGTGAAGAATATCATTGG + Intergenic
991272434 5:64800236-64800258 CATTCTTTGCAGAGCATGAAGGG + Exonic
992026587 5:72675837-72675859 AATTCTGTGAAGAATATCAATGG + Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992712591 5:79474760-79474782 AATTCTCTGCAGAAACTGAAAGG + Intronic
993354256 5:86886178-86886200 ACTTCAATGCAGAATAAGAAAGG - Intergenic
994255994 5:97596762-97596784 AATTCTGTGAAGAATATCAATGG - Intergenic
994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG + Intergenic
994624688 5:102203876-102203898 AATTCTGTGAAGAATATCAATGG - Intergenic
994774902 5:104028570-104028592 CACATTATGCAGAATATAAATGG - Intergenic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
994785114 5:104149650-104149672 CATTCTGTGAAGTATATCAATGG - Intergenic
995427440 5:112041689-112041711 CAGTCTATGAAGAGTATGCATGG - Intergenic
996202304 5:120691340-120691362 TGATCTTTGCAGAATATGAAAGG + Intergenic
996648407 5:125844035-125844057 AATTCTATGAAGAAAATCAATGG - Intergenic
996857061 5:128020093-128020115 CTTGCTATCCAAAATATGAATGG + Intergenic
997049547 5:130363226-130363248 CATTCTATAGAGAATATCCAGGG - Intergenic
997191238 5:131937928-131937950 CATACTATTCAGAATCTGAATGG + Intronic
998189209 5:140008174-140008196 GAGTCTATGCAGAAGATGCATGG + Intronic
998633763 5:143929802-143929824 CCTTCTCTGCAAAATAGGAATGG + Intergenic
998732670 5:145098240-145098262 CATACTATGTTGAATATGAGTGG - Intergenic
998759616 5:145418354-145418376 AATTCTGTGAAGAATATAAATGG - Intergenic
999020272 5:148157930-148157952 AATACTATGCAGCAAATGAAGGG - Intergenic
999942726 5:156562249-156562271 CATATTATACAGGATATGAAGGG + Intronic
1000283160 5:159800043-159800065 CATTCCATTCAGAATATGATGGG + Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1000625909 5:163538028-163538050 AATTCTATGAAGAATGTCAATGG + Intergenic
1000789572 5:165588947-165588969 AATTCTATTTAGAATATGACTGG - Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1001840009 5:174867582-174867604 AGTTCAATGCAGAATAGGAATGG + Intergenic
1003902204 6:10665074-10665096 AATTCTATGAAGAATGTCAATGG + Intergenic
1004028373 6:11841306-11841328 AATACTATGCAGAATACGAGTGG - Intergenic
1004336941 6:14772313-14772335 CATGCTATGCAAACTATGCAAGG + Intergenic
1004949347 6:20651079-20651101 AATTCTATGAAGAATGTCAATGG + Intronic
1005804896 6:29465322-29465344 CATTCTAAGTAGACCATGAAAGG + Intergenic
1005912671 6:30325166-30325188 GATTTTATGCTGAATATGGAAGG - Intergenic
1007516536 6:42417358-42417380 CCTCCTATGCACAGTATGAAGGG + Intronic
1008282906 6:49617325-49617347 CATGCTATGAAAAATATGTAGGG - Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1008801860 6:55378244-55378266 CATTCTATGAAGAATTTTGATGG + Intronic
1009443828 6:63715749-63715771 CATTTTATGGAGAATAGGGAAGG + Intronic
1009725081 6:67528766-67528788 GATTCTATGAAGAATTTCAATGG - Intergenic
1010007681 6:71013134-71013156 CATTCTGCTCAGAATATGACTGG - Intergenic
1010740478 6:79497014-79497036 CATTTCATGAAGAATATGGATGG - Intronic
1010949108 6:82013935-82013957 CTTTCTGTTCAGAATGTGAAAGG + Intergenic
1011088916 6:83572758-83572780 CCTTCTGTGCAGAATTAGAAAGG - Intronic
1011480324 6:87787409-87787431 CATACTATGGAGGATAAGAAGGG + Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012143043 6:95647466-95647488 AATTCTGTGAAGAATATCAATGG - Intergenic
1012232232 6:96773486-96773508 AATTCTATGAAGAATGTCAATGG - Intergenic
1013142976 6:107358539-107358561 CATTCTATGGAGAATAAAGATGG + Intronic
1013440478 6:110160370-110160392 CATTAGATACAGAATAAGAAAGG + Intronic
1014085212 6:117334461-117334483 AATTCTATGAAGAATGTCAACGG - Intronic
1014327993 6:120023700-120023722 AATTCTATGAAGAATGTCAATGG + Intergenic
1014371996 6:120621402-120621424 CATTTTATATAAAATATGAATGG + Intergenic
1014560224 6:122880828-122880850 AATTCTATGCAGAAAGTCAATGG + Intergenic
1016450624 6:144178758-144178780 CATTCAAAGCAAAATTTGAAAGG - Intronic
1016964960 6:149710257-149710279 TATTCTAAGCCAAATATGAATGG - Intronic
1017302766 6:152881769-152881791 AATTCTGTGGAGAATATCAATGG - Intergenic
1017573516 6:155774704-155774726 AATTCTATGAAGAATGTCAATGG + Intergenic
1018036184 6:159883759-159883781 CCTTCTTTGCAAACTATGAAAGG - Intergenic
1018074242 6:160196801-160196823 CATTATATCCAGAATATAAAAGG + Intronic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020405612 7:7830329-7830351 CATTCTAGGCTGGAAATGAAGGG - Intronic
1022873893 7:34507931-34507953 CATTCTCTCTAGAAGATGAAAGG + Intergenic
1023897820 7:44448834-44448856 CATTTTGTTCAGAATATCAAGGG + Intronic
1024108795 7:46123191-46123213 AATTTTATCAAGAATATGAAAGG - Intergenic
1024733875 7:52282166-52282188 AATTCTGTGCAGAATATCATTGG + Intergenic
1024841560 7:53593092-53593114 AATTCTATTCAGAATAGAAATGG - Intergenic
1024859970 7:53827314-53827336 AATTCTGTGAAGAATATCAATGG - Intergenic
1025234281 7:57223372-57223394 CATTCTATGAAGAGCATGGAGGG - Intergenic
1027414535 7:77961230-77961252 CATTGTAGGCAGCATATAAATGG - Intergenic
1028009059 7:85617190-85617212 AATTCTATGAAGAATCTCAATGG - Intergenic
1028077028 7:86529352-86529374 AATTCTATGAAGAATATCACTGG + Intergenic
1028297555 7:89153994-89154016 TATTCTGTTCAGAATATGTAAGG + Intronic
1028933581 7:96441411-96441433 CATTCTATGATGAGAATGAATGG + Intergenic
1029415208 7:100438171-100438193 CATTCTACACAAAAAATGAAAGG - Intergenic
1030407729 7:109135763-109135785 GATGCTATGCAGAATCTAAAGGG - Intergenic
1030438591 7:109556546-109556568 AATTCTGTGAAGAATATCAATGG - Intergenic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1030741074 7:113110589-113110611 CAGTCAAGGCAGAAAATGAATGG - Intergenic
1030845443 7:114403130-114403152 CATAATATACAGACTATGAAGGG - Intronic
1031846983 7:126817396-126817418 GATACTATGGAGAATATGCATGG + Intronic
1032656243 7:133933577-133933599 CATAATAAGCAGAAGATGAAGGG + Intronic
1033373802 7:140737290-140737312 CATTCTATGTAAAATTTTAAAGG - Intronic
1033946880 7:146729743-146729765 TTTTCTATGCAAAATGTGAAAGG + Intronic
1034082275 7:148290039-148290061 TGTTATATGCAGAATATAAAGGG + Intronic
1036496870 8:9277696-9277718 CCTTCTCTTCAGAATATGGAGGG + Intergenic
1037233750 8:16691469-16691491 CATTCTCAGCAGAATGTGAGCGG - Intergenic
1038015002 8:23507381-23507403 TATTCTTTGCAAAATCTGAAGGG + Intergenic
1038829359 8:31040094-31040116 GATTAGATGCAGAATGTGAAAGG + Intronic
1039007317 8:33054230-33054252 AATTCTGTGAAGAATATCAATGG - Intergenic
1039632379 8:39126195-39126217 AATTCTATGAAGAATGTCAATGG + Intronic
1040440202 8:47433488-47433510 TAGTCTAGGCAGAACATGAATGG + Intronic
1040703438 8:50095653-50095675 CATTCTTTTCTGAATATTAAGGG - Intronic
1042247511 8:66722810-66722832 CAATCATTGCAGAACATGAAGGG + Intronic
1042365730 8:67934347-67934369 CAATCATGGCAGAATATGAAGGG - Intergenic
1042643885 8:70964491-70964513 AATTCTGTGAAGAATATCAATGG + Intergenic
1042924080 8:73949104-73949126 CACTGTATGCTGAATATAAAAGG + Intronic
1043027941 8:75094511-75094533 AATTCTGTGAAGAATATCAATGG + Intergenic
1043414765 8:80035417-80035439 TATCATATCCAGAATATGAAGGG + Intronic
1044771220 8:95636661-95636683 AATACTATGCTGAATAGGAATGG - Intergenic
1046040447 8:108897057-108897079 CATTCATGGCAGAACATGAAGGG - Intergenic
1046110974 8:109724163-109724185 CCTTCTAAGCAGCATATGATTGG - Intergenic
1047126069 8:121961979-121962001 CAATCCTGGCAGAATATGAAGGG - Intergenic
1047548253 8:125840376-125840398 CATATAATGCAGAATATGGATGG + Intergenic
1047810853 8:128407428-128407450 AATTCTATACAAAGTATGAAAGG - Intergenic
1048865652 8:138759631-138759653 CATTCTTTGCAAAATGTGAAGGG - Intronic
1050479585 9:6075970-6075992 CATTGGATGCAGAATAAGAGGGG - Intergenic
1050973502 9:11907924-11907946 AATTCTATGAAGAAAATCAATGG + Intergenic
1050974872 9:11925077-11925099 AATACTATGCTGAATATAAATGG + Intergenic
1050986976 9:12094721-12094743 ATTTCTATGAAGAATATGGAAGG - Intergenic
1052053390 9:23875431-23875453 AATTCTATGCAGACTTTAAAAGG - Intergenic
1052288917 9:26820449-26820471 AATTCTATGCAGAATTGCAATGG - Intergenic
1055523246 9:77103827-77103849 AATTCTGTGAAGAATATCAATGG - Intergenic
1056096142 9:83255987-83256009 AATTCTGTGAAGAATCTGAATGG - Intronic
1057371904 9:94480723-94480745 CTTTTTCTGCAGAATCTGAAGGG + Intergenic
1057670494 9:97082960-97082982 AATTCTATGAAGAATTTCAATGG - Intergenic
1059051348 9:110930181-110930203 CATCCTATGGAGAAGAAGAAGGG - Intronic
1059069004 9:111115645-111115667 CATTCTATGTAGATTATGCAAGG - Intergenic
1059814285 9:117894127-117894149 TATAATATGTAGAATATGAATGG - Intergenic
1059920003 9:119149541-119149563 CATTCAATTTAGAATATGAAGGG - Intergenic
1060127002 9:121057352-121057374 CATTCTATTAAGTATATGAGTGG - Intergenic
1060159382 9:121346498-121346520 CATTCTACGTAGTATATGTATGG + Intronic
1062414540 9:136441545-136441567 CTTTCCATCCAGAATCTGAAAGG + Exonic
1186379502 X:9043066-9043088 AATTCTATGAAGAATGTCAATGG - Intronic
1187605602 X:20879203-20879225 AATTCTGTGAAGAATATCAATGG - Intergenic
1188229687 X:27646031-27646053 AATTCTGTGAAGAATATCAATGG - Intronic
1188513619 X:30962161-30962183 CATTCTATGTAAAATAGAAATGG - Intronic
1191004061 X:55691497-55691519 AATTCTGTGCAGAAAATCAATGG - Intergenic
1191746025 X:64487961-64487983 AATTCTATGAAGAATATCAGTGG + Intergenic
1192929884 X:75794974-75794996 AATTCTGTGAAGAATATCAATGG + Intergenic
1193589295 X:83367612-83367634 CATTCTATGAAGAATGTCAATGG + Intergenic
1193869574 X:86780364-86780386 CATAGTATTCAGAATATGGATGG + Intronic
1194116456 X:89904898-89904920 ATTTCTATGAAGAATATCAATGG - Intergenic
1194221159 X:91193181-91193203 AATTCTATGAAGAATGTCAATGG - Intergenic
1194235377 X:91376956-91376978 GATTCTAAGCCGAATAGGAATGG - Intergenic
1194436950 X:93878302-93878324 CATTCTGTGAAGAATGTTAATGG - Intergenic
1194706449 X:97181030-97181052 AATTCTATGAAGAATGTCAATGG + Intronic
1194911091 X:99645442-99645464 AATTCTGTGAAGAATATTAATGG + Intergenic
1195042450 X:101026906-101026928 CATTTTAAGCAGAATAAAAAAGG + Intronic
1195213691 X:102675636-102675658 AATTCTGTGAAGAATATCAATGG + Intergenic
1195488207 X:105435236-105435258 AATTCTGTGCAGAATGTCAATGG + Intronic
1196086813 X:111692639-111692661 GATTCTATGCAGTATCTTAATGG + Intronic
1196475189 X:116076259-116076281 AATTCTATGCAGAATGTCACTGG - Intergenic
1196537509 X:116864822-116864844 AATTCTATGAAGAATGTCAATGG + Intergenic
1196692076 X:118570733-118570755 CATTGTAGGCAGAAAATGATTGG - Intronic
1196945457 X:120820503-120820525 AATTCTGTGAAGAATATCAATGG + Intergenic
1197007688 X:121522473-121522495 AATTCTATGAAGAATGTCAATGG - Intergenic
1197423662 X:126268846-126268868 AATTCTGTGAAGAATATCAATGG + Intergenic
1199026965 X:142951039-142951061 AATTCTGTGGAGAATATCAATGG + Intergenic
1199588923 X:149447650-149447672 AATTCTATGAAGAATATCAATGG + Intergenic
1199621833 X:149708468-149708490 AATTCTATGAAGAAAAAGAAAGG + Intronic
1200270715 X:154680039-154680061 CTTTCTAAGGAGAATATGCATGG + Intronic
1200469256 Y:3562081-3562103 ATTTCTATGAAGAATATCAATGG - Intergenic
1200516565 Y:4150848-4150870 AATTCTGTGAAGAATATCAATGG - Intergenic
1201570906 Y:15413357-15413379 ACTTGTATGCAGAATATGTAAGG + Intergenic
1201756895 Y:17496072-17496094 AATTCTGTGAAGAATATCAATGG - Intergenic
1201758589 Y:17515442-17515464 CATTCAATGAAGAAAAAGAAAGG + Intergenic
1201842966 Y:18390548-18390570 CATTCAATGAAGAAAAAGAAAGG - Intergenic
1201844658 Y:18409912-18409934 AATTCTGTGAAGAATATCAATGG + Intergenic