ID: 1116610309

View in Genome Browser
Species Human (GRCh38)
Location 14:47061512-47061534
Sequence AAAGATGACAACATCCAGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116610309_1116610311 -8 Left 1116610309 14:47061512-47061534 CCAATCTGGATGTTGTCATCTTT 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1116610311 14:47061527-47061549 TCATCTTTGTGATAAGGATCTGG 0: 1
1: 0
2: 2
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116610309 Original CRISPR AAAGATGACAACATCCAGAT TGG (reversed) Exonic
900206280 1:1433229-1433251 AAACATGACCACAGCCAGCTGGG + Intergenic
902799708 1:18821608-18821630 AGAGATGACCTGATCCAGATTGG + Intergenic
903295027 1:22338268-22338290 AGAGATGACATCACCCAGACTGG - Intergenic
903609953 1:24603614-24603636 AAACATGACAACATACAGGCAGG - Intronic
905119109 1:35668216-35668238 AGAAATGACAAGATCCAAATAGG - Intergenic
905231781 1:36518947-36518969 AAAAATAATAAAATCCAGATGGG - Intergenic
908106432 1:60848045-60848067 AAGAATGACATCATCAAGATGGG + Intergenic
912222417 1:107693561-107693583 AAGGAAGACAACATCCAAAAAGG + Intronic
915238072 1:154500621-154500643 GAAGATAAAAACAACCAGATCGG + Intronic
916330643 1:163612420-163612442 TCAGATGACAACTTCCAGTTGGG - Intergenic
916790178 1:168118192-168118214 AAAGACGACAACCCACAGATCGG + Intronic
918807132 1:189062732-189062754 AAGGTTATCAACATCCAGATAGG - Intergenic
918895169 1:190333790-190333812 AAAGATCACAAGATATAGATTGG - Intronic
920336573 1:205249138-205249160 AGAGATGACAACGTCCTGACTGG + Intronic
920812277 1:209297618-209297640 AGGGATGACAACATCTAGCTGGG + Intergenic
923172418 1:231429851-231429873 AAAGAGGACAAGATACAGCTTGG - Intergenic
923838425 1:237640913-237640935 GAAGATGACACTATCCACATGGG + Exonic
924441845 1:244092712-244092734 AAAGATGAGAACAGGCAGAGAGG - Intergenic
924815806 1:247440964-247440986 AATGATCACAACCTCAAGATGGG - Intronic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1065036835 10:21647995-21648017 AAATAAAACAAAATCCAGATGGG - Intronic
1065439459 10:25735942-25735964 AAATGGGACAACATCCAGAATGG + Intergenic
1066424524 10:35294237-35294259 AGAAATAAAAACATCCAGATTGG - Intronic
1067094221 10:43287726-43287748 AATCTTGACAGCATCCAGATTGG + Intergenic
1068633932 10:59327579-59327601 AAAGGTGACAACATCAAGAAAGG + Intronic
1070371806 10:75789427-75789449 AGAGATGACCAGATTCAGATAGG + Intronic
1070477374 10:76843331-76843353 AAAGAAGACAACATCATGAATGG + Intergenic
1070514533 10:77191693-77191715 AATGATGATAACATCAAAATGGG + Intronic
1070804487 10:79263060-79263082 GGAGATGACAACCTTCAGATGGG - Intronic
1071286523 10:84152986-84153008 AAACATGACCACATCTATATTGG - Exonic
1074530439 10:114294442-114294464 AAAAATGACAAAATCAAAATCGG - Intergenic
1074651236 10:115526603-115526625 TAAGAGGACAACATCCATGTTGG - Intronic
1076569545 10:131423653-131423675 AAAGAAAACAAAATCCAGACAGG - Intergenic
1078355978 11:10631670-10631692 AAAGAGGCCCACATCCAGGTTGG - Intronic
1078767986 11:14318180-14318202 AAAGAAGTGAACATCCATATAGG - Intronic
1079559441 11:21803980-21804002 AAAGAGGCCAACATACAGCTTGG - Intergenic
1081479925 11:43476628-43476650 AAAGAGGCCAACATACAGCTTGG - Intronic
1081691018 11:45078581-45078603 ACAGCTGACGACATCCAGACAGG + Intergenic
1081943199 11:46963089-46963111 AAAAATAAAAGCATCCAGATTGG - Intronic
1082001960 11:47398150-47398172 AGAGATGATAAAATCCAGAAAGG + Intergenic
1082666180 11:55978990-55979012 AAAGAAGACAATATTCACATAGG + Intergenic
1082789008 11:57334566-57334588 AAAGTGGACAACATCCAGGCTGG - Exonic
1085252088 11:75150718-75150740 AAAGAGGACAACTGCTAGATGGG + Intronic
1087061246 11:93979970-93979992 AATGATCACAACTTCCAAATTGG - Intergenic
1087077617 11:94140080-94140102 AAAGATTACAACTTCCAGATCGG + Intronic
1087346731 11:96981382-96981404 AAAGATGGCAACAACAAGAAGGG - Intergenic
1088233053 11:107692846-107692868 AAAGAAAACCACAGCCAGATGGG + Intergenic
1088315529 11:108502591-108502613 AAAGATGACATAATCTAGAAAGG + Intergenic
1090912772 11:131135843-131135865 AAAGATGCCAACATGCAGCAGGG - Intergenic
1091863304 12:3806306-3806328 AGAGATGAGAAAAACCAGATAGG - Intronic
1092185666 12:6476607-6476629 AAAGATGAGTTCATCCAGAAAGG + Intergenic
1092274724 12:7050788-7050810 AAAGCTGACAAAATCAAGAATGG - Intronic
1092602924 12:10086539-10086561 AAAGATCACAAAGTCCAGAGGGG + Intronic
1093045783 12:14442778-14442800 AAAGGAGACAAGATCCAGAAGGG + Intronic
1093681316 12:22006996-22007018 AACCATGTCAACATCCAAATTGG - Intergenic
1093885810 12:24459059-24459081 CAAGAAGTCAACATCCAAATAGG + Intergenic
1094251468 12:28366962-28366984 AAAAATGAAAACCTCCAGGTAGG - Intronic
1095515714 12:43003073-43003095 AAATGAGACAACATCCAGAGAGG - Intergenic
1095887694 12:47206106-47206128 TCAGCTGACACCATCCAGATCGG - Intronic
1096435530 12:51587827-51587849 AACGACGACGACATCTAGATTGG + Intergenic
1096575755 12:52551827-52551849 AGAGATGACACAGTCCAGATAGG - Intronic
1097778047 12:63669930-63669952 GAAGGTGACAGCATTCAGATGGG - Intergenic
1098170903 12:67746190-67746212 AAAGATGACACTAACCAGATGGG - Intergenic
1098948361 12:76613257-76613279 AAAGATGGCAACATAGACATTGG + Intergenic
1100678441 12:96893381-96893403 AAAGGTGCCAACATACAGCTTGG + Intergenic
1100683264 12:96954331-96954353 ATATATGACAATATCAAGATTGG + Intergenic
1100730386 12:97460860-97460882 AAAGGTAATAACATCTAGATGGG + Intergenic
1100734780 12:97514252-97514274 CCAGATGACAACATCCTTATGGG + Intergenic
1102623035 12:114211865-114211887 AAAGATGACAAGATACTTATTGG - Intergenic
1105329316 13:19400465-19400487 AAAAATGACCACATTTAGATAGG + Intergenic
1105862535 13:24428803-24428825 AAAAATGACCACATTTAGATAGG - Intronic
1106956903 13:34949296-34949318 AAAGCTGACAAGATCCTGACAGG + Intronic
1107408856 13:40140131-40140153 AAAGAAGACAATATACATATTGG + Intergenic
1107518727 13:41158604-41158626 AAAGATGACAAAAACCCCATAGG + Intergenic
1107705495 13:43099357-43099379 AAAGAAAAAGACATCCAGATTGG - Intronic
1108274508 13:48793909-48793931 AAAAATGACCACATCAAGTTTGG - Intergenic
1109054717 13:57532988-57533010 AAAGATGACAAAAGCCCTATAGG + Intergenic
1109609777 13:64749508-64749530 AGAGAGTACAACATCCACATGGG - Intergenic
1113058362 13:106294469-106294491 AAAGAAGACAGCATTCAGACAGG + Intergenic
1113190908 13:107744521-107744543 AAAGAGGACAAAAGACAGATAGG + Intronic
1113436112 13:110292434-110292456 AAAAATAACCACCTCCAGATTGG - Intronic
1114974081 14:28072528-28072550 AGAGATGGCAACATTTAGATAGG + Intergenic
1115996221 14:39198470-39198492 AAAGCTGACAAAATCCATGTTGG - Intergenic
1116610309 14:47061512-47061534 AAAGATGACAACATCCAGATTGG - Exonic
1117308253 14:54497331-54497353 AAAGATGACAAAAGCCCCATAGG + Intergenic
1117415835 14:55494714-55494736 AAAGACGACCACATCCAGTGGGG - Intergenic
1119004864 14:70915221-70915243 AAAGATGCCAACATGAGGATAGG + Intronic
1119155738 14:72408892-72408914 AAAGAAGACATCATCCAGCAAGG - Intronic
1121391081 14:93575309-93575331 AAAGATGAACACAGCGAGATGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127881643 15:63163348-63163370 AAAGAGGACCACATCCTGACAGG - Intergenic
1130813741 15:87408651-87408673 AATTATGACAACATCCAGAAAGG - Intergenic
1131712302 15:95068982-95069004 AAAGATGACACCTACCTGATGGG - Intergenic
1131713721 15:95085246-95085268 AGAGATGACATCTTTCAGATGGG - Intergenic
1133627527 16:7585270-7585292 ATAGAAGAAAACATTCAGATTGG - Intronic
1135713965 16:24744751-24744773 AAAGAGGACAACAGACAGAGTGG - Intronic
1135787170 16:25360570-25360592 AAAGATGGCAAAATCCAAAATGG + Intergenic
1136668256 16:31833498-31833520 AATGATGTTAACATCCACATAGG - Intergenic
1137021763 16:35435287-35435309 AAAGAACACAACATTGAGATAGG - Intergenic
1138986549 16:62335762-62335784 AAAGATGAAAACATACAAATTGG + Intergenic
1139077189 16:63465486-63465508 AAAGATAACAAGATCCAGTCTGG - Intergenic
1139686218 16:68605716-68605738 ACAGATGACACCATTTAGATAGG - Intergenic
1144231539 17:13209835-13209857 AAAGAAAACAACATACAGAATGG - Intergenic
1147228937 17:39003107-39003129 AAAGAAGAAAACAGCCAGATGGG - Intergenic
1150993065 17:70283314-70283336 AATGATTACAACTTCCAGAGGGG - Intergenic
1151292529 17:73160902-73160924 AAAGATGATAAAAACCACATTGG + Intergenic
1153143086 18:1997291-1997313 AGAGATGACAGGATCTAGATAGG + Intergenic
1154130980 18:11736951-11736973 GAATATGAAAACATACAGATAGG + Intronic
1155502793 18:26503943-26503965 AAAGAGGAGAACATCCAGGATGG - Intronic
1155794195 18:30013493-30013515 AAAGTTGACAACAACCAAATGGG + Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1159420271 18:68209442-68209464 AAAGTTAACAACCTCCAGAATGG - Intergenic
1159534023 18:69692277-69692299 AAAGTTGACAATATCCTTATGGG + Intronic
1161467207 19:4437714-4437736 AAAGATGAAAACTTTCAAATTGG - Intronic
1165197565 19:34116829-34116851 AAAGATGAAAGCAGCCAGACAGG + Intergenic
1165406002 19:35631510-35631532 TAGGATGACAACATCAAGTTGGG - Intronic
1166489881 19:43249623-43249645 AAAAATGTCCACATCCAGGTCGG + Intronic
1167466766 19:49654313-49654335 AGAGGTGACAACATGAAGATGGG - Intronic
1168536849 19:57178011-57178033 AAAGAAGACAAGATACAGATTGG + Intergenic
925457112 2:4025163-4025185 AAATAAGAAAACATACAGATTGG - Intergenic
926694415 2:15761165-15761187 AAAGATGATAAAATTCAGAATGG - Intergenic
927500965 2:23582920-23582942 CAAGATGAGACCATCTAGATTGG + Intronic
928448763 2:31358927-31358949 GGAGATGAAAACATGCAGATTGG + Intronic
928716622 2:34068643-34068665 AATGATGATAACATACAGACTGG + Intergenic
928785020 2:34873671-34873693 AAAGATGGTCACTTCCAGATTGG + Intergenic
930164460 2:48190702-48190724 AAAGTTGAAAACCTCTAGATGGG - Intergenic
931798255 2:65732861-65732883 AAAGAAGAAAACATCAAGAGTGG - Intergenic
934150098 2:89138241-89138263 AAAGATGAGAGGATCCAAATGGG - Intergenic
934217196 2:90043788-90043810 AAAGATGAGAGTATCCAAATGGG + Intergenic
935836119 2:107056011-107056033 TAAGCTGACAACTCCCAGATGGG + Intergenic
936951699 2:117984061-117984083 AATAATGACAACATTCAGAAAGG - Intronic
938147640 2:128849935-128849957 AATGATGATGACATACAGATGGG - Intergenic
938701972 2:133887678-133887700 CAAGTTGGCAACATCCTGATGGG - Intergenic
940517856 2:154703537-154703559 AAACAAGACAACATCCAATTTGG - Intronic
941761340 2:169247377-169247399 TATGATGTCAACATCCAGACTGG - Exonic
945693676 2:213075480-213075502 CATTATGACAACATCCACATTGG - Intronic
946612004 2:221468868-221468890 CAAGATGACAACAACCATAGTGG - Intronic
947149724 2:227102854-227102876 AGAGATGACAACATTTAGAGGGG + Intronic
947261391 2:228227465-228227487 GAAGGTGACAAAATCAAGATTGG - Intergenic
947427279 2:229995184-229995206 AAAGATCAGAAAATACAGATAGG + Intronic
949055158 2:241923894-241923916 CAAAATGATAACATTCAGATAGG - Intergenic
1168898914 20:1343307-1343329 AAAGATGATAACATCCAGGCTGG + Intronic
1169802073 20:9520798-9520820 AAAGATGTCAACCTCCATTTGGG - Intronic
1170479239 20:16748617-16748639 AAAGCTGATAACATACACATTGG - Intronic
1171121384 20:22571967-22571989 AAAGAGGACAAAATACAGATTGG + Intergenic
1172503064 20:35440711-35440733 AAATATGACAAAATACAGAGTGG - Intronic
1173401060 20:42726373-42726395 AAAGATGCCCACATCCAGGCTGG - Intronic
1175311716 20:58017054-58017076 GAAGATGAGACCACCCAGATGGG - Intergenic
1177394108 21:20511008-20511030 AAAGGGGACAACATACAGCTTGG - Intergenic
1180149034 21:45938352-45938374 TAAGATGCCAACATCCAGGAGGG - Intronic
949818773 3:8092410-8092432 AAAGAAGAGAACATCAAAATTGG + Intergenic
950732821 3:14976894-14976916 AAAGATCTTAACAACCAGATTGG - Intronic
951613386 3:24517361-24517383 AAATATGACCATATCCAGCTTGG - Intergenic
959306724 3:104676662-104676684 GAAGATAAAAACATCCAAATAGG - Intergenic
959630379 3:108500800-108500822 CAAGATGATGACATCCAGGTGGG + Intronic
960539433 3:118847402-118847424 AAGGATGAAAACGTCCAGGTGGG - Intergenic
962045758 3:131757843-131757865 AAAGGGGACAACATACAGCTTGG + Intronic
962855127 3:139338335-139338357 AATGATAACAACTTCCACATAGG - Intronic
962899556 3:139747142-139747164 AAAGTAGACATCATGCAGATGGG + Intergenic
963089417 3:141468651-141468673 AAAAATGAAAACAGACAGATAGG - Intergenic
964180416 3:153876838-153876860 AAAGCAGACAACATACAGAAGGG - Intergenic
964935568 3:162081509-162081531 AAAGAAGACAAGATCAAGATTGG + Intergenic
965124312 3:164605307-164605329 ATTGATGAAAACATCCAGATTGG - Intergenic
965316003 3:167191296-167191318 AAAGATGATTCCATCCAGAATGG - Intergenic
967445082 3:189555926-189555948 TAAGATAAAATCATCCAGATGGG + Intergenic
967846435 3:194046850-194046872 TAAAAGTACAACATCCAGATTGG + Intergenic
968274809 3:197432511-197432533 AAAGCTGACAAGAGCCAGACTGG + Intergenic
968933376 4:3596327-3596349 AAAGATGTCAACAGGCAGGTCGG - Intergenic
969040637 4:4292879-4292901 AAAGAAAACAACAGCCAGAATGG - Intronic
969243406 4:5916696-5916718 AGAGAAGACAATATCCAGATGGG + Intronic
972461019 4:39302390-39302412 AAATAAGACAACGTCAAGATAGG + Intronic
972663276 4:41138757-41138779 AATAATAATAACATCCAGATTGG + Intronic
973659669 4:53090525-53090547 AAGGATCATAAGATCCAGATAGG + Intronic
973671443 4:53222813-53222835 AAAGATAACAGTAACCAGATAGG - Intronic
974265063 4:59576587-59576609 AGAAATGAAAACATCCAGTTAGG + Intergenic
974427486 4:61759821-61759843 GATGATGACAACATACAGATGGG + Intronic
974847082 4:67364095-67364117 CAAGATGATTTCATCCAGATTGG - Intergenic
975899502 4:79134971-79134993 AAAGAAAAAAGCATCCAGATAGG - Intergenic
977593499 4:98852397-98852419 AAAGATGTAATCATCTAGATCGG + Intergenic
978345338 4:107761847-107761869 AAAGTTGACAATATCAAAATTGG + Intergenic
978456715 4:108900823-108900845 TAAAATGACAACAGCCATATTGG + Intronic
983096233 4:163565604-163565626 AAAGATGAAAAAATCTAGGTGGG + Intronic
986100399 5:4603736-4603758 AAAGATAACGACATTCCGATGGG + Intergenic
986954056 5:13128786-13128808 AAAAAAGAAAACATCCAAATTGG + Intergenic
988982881 5:36589059-36589081 AAGGAAGAAAACATCCAGATGGG - Intergenic
990125811 5:52516707-52516729 AAACATAAAAACATCCAAATTGG + Intergenic
990579328 5:57152948-57152970 AAAGAAGATAACATCCGGCTGGG + Intergenic
990590305 5:57255959-57255981 CAAGATGAAAACATCCGGCTGGG + Intronic
992192836 5:74310868-74310890 AAAGCTGCCAAAATCCAGAGAGG - Intergenic
992234258 5:74692968-74692990 AAAGTTCACATCATCCAGAATGG - Intronic
993274927 5:85844625-85844647 AAAGAGGACAAAATCAAAATGGG - Intergenic
993744482 5:91579963-91579985 ATGGATGACTCCATCCAGATTGG - Intergenic
995530274 5:113085356-113085378 AAAGAGCAAAACAGCCAGATGGG + Intronic
995700247 5:114927931-114927953 AAAGATGACACCATTTAAATTGG + Intergenic
997102467 5:130983932-130983954 AAAAAGGACAATATCCAGTTTGG - Intergenic
997927834 5:138047208-138047230 AAAGATGTCCACATTCAGACCGG + Intronic
998767352 5:145502612-145502634 AAAGATCTCAACATTCAGTTGGG - Intronic
999540139 5:152562248-152562270 AAACATGAAAACATCCAAAGTGG - Intergenic
1000429748 5:161137005-161137027 ATAGATGACAACAACAAAATAGG - Intergenic
1000685552 5:164244694-164244716 AAAGATGACATCTTCCAGCAAGG - Intergenic
1000840543 5:166212502-166212524 AAAAATGACAAGAGCAAGATGGG - Intergenic
1001140645 5:169140946-169140968 GAAGATGACAAGATGGAGATTGG - Intronic
1001548502 5:172585488-172585510 AAAGATGACAATTTCCAAGTGGG + Intergenic
1001563956 5:172687639-172687661 AAAGATGACACAATCCAGAGGGG - Exonic
1003124990 6:3348956-3348978 AAAGATGACTATTTCCAGAGTGG - Intronic
1003154764 6:3582135-3582157 AAAGAAGACAACAGCTAAATAGG - Intergenic
1005100846 6:22171508-22171530 GATGATGACCACATACAGATGGG + Intergenic
1005172459 6:23004046-23004068 AAAAATAACAAGATCCAGATGGG + Intergenic
1009762588 6:68026883-68026905 AAAGAATACAAAAACCAGATGGG + Intergenic
1009811064 6:68667662-68667684 AAAAATAACAACATGCAGCTTGG - Intronic
1010148087 6:72695519-72695541 AAAGATAATAACATTCAGAGAGG - Intronic
1011470807 6:87705623-87705645 AATGATGAAAATATGCAGATAGG - Intergenic
1012026036 6:93993012-93993034 AAAGGTGACACCTTCCAGAAAGG - Intergenic
1012073307 6:94651409-94651431 ATTGATGACATCATCCAAATTGG - Intergenic
1013258332 6:108411746-108411768 GATGATGGCAACATACAGATGGG - Intronic
1013752608 6:113424562-113424584 AGACATGACAACATCCAGTGAGG + Intergenic
1014730978 6:125031090-125031112 AAAGAGGCCAACATACAGCTCGG - Intronic
1016279658 6:142400981-142401003 AATGAAGACAAGATCCAGATTGG + Intronic
1016316819 6:142798660-142798682 AAGGATGACCTCATGCAGATGGG + Intronic
1016435151 6:144029353-144029375 AAAGACAACAACAACCTGATGGG + Intronic
1018032909 6:159857562-159857584 AGAGATGAAAATATCCAGACAGG - Intergenic
1021710523 7:23411719-23411741 AAAGATGCCAACATCCAGCAGGG + Intronic
1021739021 7:23666874-23666896 AAAGATGACATGAGCCACATAGG - Intergenic
1023023098 7:36028238-36028260 AAAGATGGCAACTTCCGGATAGG - Intergenic
1023525383 7:41097151-41097173 ACAGATGACATCATCCACAGTGG + Intergenic
1028373148 7:90117985-90118007 GAAGGTGACAGCATTCAGATGGG + Intergenic
1029059924 7:97786582-97786604 GATGATGACGACATACAGATGGG - Intergenic
1029101530 7:98134868-98134890 AAAGTTGACTTCCTCCAGATTGG + Intronic
1029564299 7:101325285-101325307 AAAGATGACAGCATTCATAGGGG - Intergenic
1029833211 7:103281702-103281724 GAAGGTGACAGCATTCAGATGGG - Intergenic
1030762384 7:113367747-113367769 AAAATTGACAACTTACAGATAGG + Intergenic
1031570339 7:123351328-123351350 GAAGATGAAAACACCCAAATAGG - Intergenic
1033134868 7:138775981-138776003 AAATATGACAACATAAAGACAGG + Intronic
1035563210 8:623950-623972 AAAGAAGACAACATACAGAATGG + Intronic
1036447697 8:8836826-8836848 AAAAATGGCAAGATTCAGATGGG - Intronic
1038465704 8:27760690-27760712 AATGCTGAAAACATCCAGACTGG - Intronic
1039096462 8:33891974-33891996 AATGATGACAAACTCCAGAATGG + Intergenic
1041920250 8:63174352-63174374 AAATATTACAAGATCCAAATAGG - Intronic
1042442624 8:68845741-68845763 AAAGATGACAAAAACCCCATAGG - Intergenic
1042509130 8:69592937-69592959 AAAGATAACACAGTCCAGATTGG - Intronic
1043964855 8:86462671-86462693 AAAGATGACATCCTAGAGATAGG + Intronic
1044194598 8:89359226-89359248 AAAGATAACAACATTAAGAGTGG - Intergenic
1045808728 8:106196530-106196552 AAAGATGAGAACGTCCATTTTGG + Intergenic
1048422730 8:134293413-134293435 AATAATGACAACAGTCAGATTGG - Intergenic
1050113285 9:2238756-2238778 AAAGATGAAAATATCAAGTTTGG + Intergenic
1050614082 9:7383415-7383437 GAAGATGCTAACATCCAGAAAGG + Intergenic
1051191747 9:14519995-14520017 AAACATGATAAAATTCAGATTGG + Intergenic
1051426388 9:16935605-16935627 AAGGGAGACAACAGCCAGATTGG + Intergenic
1052256749 9:26466017-26466039 AAAAATGGCAACATCCGGCTAGG - Intergenic
1052455752 9:28695329-28695351 AAAAATGATAATATCCAGTTTGG + Intergenic
1053444849 9:38144730-38144752 AGAAATGATAACATCCAGGTCGG - Intergenic
1054442763 9:65282730-65282752 AAAGATGACAATGTGCAAATCGG + Exonic
1054487515 9:65738771-65738793 AAAGATGACAATGTGCAAATCGG - Exonic
1055427645 9:76212672-76212694 AATGATGACAACCTGCATATAGG - Intronic
1056065928 9:82934561-82934583 AAAGATAATAATATCCAGTTAGG - Intergenic
1059098869 9:111450112-111450134 AATGATGACAACACCTAGTTGGG - Intronic
1059368962 9:113809514-113809536 AAAGATGAAAACACACAGATGGG + Intergenic
1059397409 9:114046191-114046213 AAAAAGAAAAACATCCAGATTGG - Intronic
1059793540 9:117666512-117666534 AAAGATGACTACACTGAGATAGG - Intergenic
1059794385 9:117676095-117676117 ACAGATGAATACATACAGATAGG + Intergenic
1060040359 9:120295176-120295198 AAAAGTGCTAACATCCAGATAGG + Intergenic
1185875815 X:3701509-3701531 AAAGATCGCAAAATCCAGCTTGG - Intronic
1186961371 X:14740240-14740262 AAGGAAGACAACAGCCAGAAAGG + Intergenic
1187749897 X:22450849-22450871 AAAGAAAACTACATCCAAATTGG + Intergenic
1190614276 X:52213873-52213895 AAAGATGAGATCAACCAGAAAGG - Intergenic
1192138701 X:68630163-68630185 AAAGGTCACAACATGCAGAGAGG + Intergenic
1192147082 X:68689130-68689152 AAAGGTCACAACATGCAGAGAGG - Intronic
1192568708 X:72184592-72184614 GAAGATGACAGCATCCAGCAGGG + Intronic
1193350494 X:80458000-80458022 AAAGAGACCAACATCAAGATTGG - Intergenic
1193995126 X:88356865-88356887 AAATATGAAAACATCCAAATTGG + Intergenic
1196559296 X:117126543-117126565 AAAGAGGACAACATAGAGCTTGG + Intergenic
1200353408 X:155522633-155522655 AAACATGAAATCATGCAGATTGG + Intronic
1200789764 Y:7288914-7288936 AAAGATTGCAAAATCCAGCTTGG + Intergenic
1200870561 Y:8093704-8093726 AAAGGTCACAACATCTAGGTGGG + Intergenic
1201794216 Y:17877158-17877180 AAAGGTGCCATCATCCAGAGAGG + Intergenic
1201807338 Y:18028827-18028849 AAAGGTGCCATCATCCAGAGAGG - Intergenic