ID: 1116614041

View in Genome Browser
Species Human (GRCh38)
Location 14:47111105-47111127
Sequence GTTAATGTATGCAAAGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116614041_1116614044 -1 Left 1116614041 14:47111105-47111127 CCAAAAGCTTTGCATACATTAAC 0: 1
1: 0
2: 1
3: 28
4: 315
Right 1116614044 14:47111127-47111149 CTCATTTAATTATAGGAGGTAGG 0: 1
1: 0
2: 4
3: 27
4: 166
1116614041_1116614043 -5 Left 1116614041 14:47111105-47111127 CCAAAAGCTTTGCATACATTAAC 0: 1
1: 0
2: 1
3: 28
4: 315
Right 1116614043 14:47111123-47111145 TTAACTCATTTAATTATAGGAGG 0: 1
1: 1
2: 3
3: 29
4: 237
1116614041_1116614042 -8 Left 1116614041 14:47111105-47111127 CCAAAAGCTTTGCATACATTAAC 0: 1
1: 0
2: 1
3: 28
4: 315
Right 1116614042 14:47111120-47111142 ACATTAACTCATTTAATTATAGG 0: 1
1: 0
2: 5
3: 50
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116614041 Original CRISPR GTTAATGTATGCAAAGCTTT TGG (reversed) Intronic
900492950 1:2961766-2961788 GCTTATGTTTGCAAAGCGTTGGG - Intergenic
901666827 1:10830893-10830915 TTTAGTGTATGCAAAGCTGCTGG + Intergenic
902915913 1:19639301-19639323 ATAAATGGATGCAAAGCTCTCGG - Intronic
903582694 1:24384059-24384081 GTTAATGGATGTAAAGCCTGTGG - Intronic
905400035 1:37694621-37694643 GTTAATGTATGTAAAACACTTGG - Intronic
905809790 1:40903732-40903754 GGTAATGGATGCAGAGTTTTGGG + Intergenic
906160572 1:43646170-43646192 GTTAATGTCCTCATAGCTTTAGG - Intergenic
908129839 1:61064186-61064208 GGTAATGTATGCACATCTTCAGG - Intronic
909061849 1:70888021-70888043 GTTAAAGCATGCAAAGCTGTGGG + Intronic
909722398 1:78790807-78790829 GATAATATAAGCAAAGCCTTTGG - Intergenic
909916970 1:81332512-81332534 TTTAATGTTTCCAAAGCTCTTGG - Intronic
910046033 1:82918019-82918041 GTAAATATATACAAAGTTTTTGG - Intergenic
910655533 1:89614670-89614692 GTCAATGAGTGCAGAGCTTTGGG - Intergenic
912478698 1:109961004-109961026 GAAAATGTATGCAAAGAGTTTGG - Intergenic
912659908 1:111518304-111518326 GATAATGTATGCAAAGTGTCTGG - Intronic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
915510365 1:156383625-156383647 GTTAACGTCTGCAAAGCACTAGG + Intronic
915512628 1:156394664-156394686 GATAATGTATGTAAAGTGTTTGG - Intergenic
915572856 1:156754590-156754612 GTTAACGTCTGCAAAGCACTAGG - Intronic
916655451 1:166871492-166871514 GTAGTTGCATGCAAAGCTTTGGG + Intronic
916995972 1:170301690-170301712 GATAATGTAAGCAAAGCATTTGG - Intergenic
917831885 1:178899266-178899288 GGTAATGTATGCAAAATGTTTGG + Intronic
918469796 1:184860212-184860234 TTTAGGGTATGCAAAGCTGTAGG + Intronic
919750655 1:201035772-201035794 ATTAATATATGCAAAACCTTTGG + Intergenic
920600043 1:207315342-207315364 AATAATGTATGTAAAGCATTTGG - Intergenic
920695311 1:208177470-208177492 GTTAATACATGCAAAGCTCTAGG + Intronic
923069803 1:230552122-230552144 ATGAATATATGCAAAGCTCTTGG - Intergenic
923903881 1:238361307-238361329 GTTAATTTATGTATAACTTTTGG + Intergenic
1063061872 10:2563876-2563898 GTTAATGTTTGGAAACCTGTTGG - Intergenic
1063941801 10:11137605-11137627 CTTAATGTATGCCAGACTTTGGG - Intronic
1065052344 10:21808292-21808314 GTTTATGTATGCAGAGTATTTGG - Intronic
1065214366 10:23436369-23436391 GTTATTCTATGCTAAGTTTTGGG + Intergenic
1066313801 10:34223344-34223366 TTAAATGTATGCATTGCTTTTGG - Intronic
1066510801 10:36093441-36093463 GTCAATGTATGCAAAGTCTTTGG - Intergenic
1068499936 10:57832315-57832337 GATAATGTGTGTAAAGCATTTGG - Intergenic
1068615075 10:59105319-59105341 AATAATGTATGTAAAGCATTTGG + Intergenic
1069018488 10:63459563-63459585 ATTAATTTTTACAAAGCTTTGGG + Intronic
1069417538 10:68214257-68214279 AGTAATGGATGAAAAGCTTTGGG - Intergenic
1070652895 10:78250906-78250928 GTTATTATATGCAGAGCTCTTGG + Intergenic
1070939426 10:80330126-80330148 GAGAATGGATGCAAAGGTTTGGG - Intergenic
1071454093 10:85829586-85829608 GTCAATTTCTGCAAAGTTTTAGG + Intronic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1073446928 10:103586640-103586662 GTTAATGCATGTAATGCTGTTGG + Intronic
1073784756 10:106877110-106877132 TTTAATGTCTGAAAATCTTTAGG + Intronic
1073937798 10:108655068-108655090 GTTAATATATGTAAAGAATTTGG + Intergenic
1074060147 10:109957944-109957966 GCAAATGTTTGCAAAGCTCTTGG - Intergenic
1074482417 10:113836449-113836471 TTTTATGTGTGCAAAGCTTGGGG - Intronic
1075890153 10:125941895-125941917 GATAATGTATGCAAAACTGGTGG + Intronic
1076190860 10:128482466-128482488 GCTCATGTATGCAAAGCGCTTGG - Intergenic
1077917037 11:6618097-6618119 GTAAATGTTTTCAAATCTTTCGG + Intronic
1078924036 11:15858199-15858221 GTTAATGCATGTAAAGCTACCGG - Intergenic
1078931812 11:15918430-15918452 GTTAATGAGTGCAGAGCTTCAGG - Intergenic
1079478934 11:20860696-20860718 GTTAATTTATATAAGGCTTTTGG + Intronic
1081230428 11:40579557-40579579 GGTAATGATTGCAAAGCTCTAGG - Intronic
1081702846 11:45162869-45162891 CTGAATGAATGGAAAGCTTTGGG + Intronic
1082805993 11:57450918-57450940 GATAATGTATATAAAGCTTCTGG + Intergenic
1083715567 11:64573685-64573707 GTTAAAGTGTTCAAAGTTTTTGG - Intergenic
1086218998 11:84418937-84418959 TTTAGTATATGCAAAACTTTTGG + Intronic
1088051370 11:105519236-105519258 ATGAATGAATGCAAAGCTATTGG + Intergenic
1089138438 11:116267834-116267856 GTGAATGAATGCAAAGGCTTTGG - Intergenic
1090236023 11:125147692-125147714 GTTAATGCATGCAAAGGACTTGG + Intergenic
1090774241 11:129949094-129949116 GGCAATGGATGCAAAGCTGTGGG - Intronic
1092071504 12:5635085-5635107 GTCAATGCGTGCAAGGCTTTTGG - Intronic
1093194577 12:16114936-16114958 CTTATTGAATGCAAAGCCTTAGG - Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094175842 12:27540314-27540336 GATAATGAATGCAAAGAGTTTGG + Intronic
1094331593 12:29300071-29300093 CTGAATGAATGAAAAGCTTTTGG + Intronic
1095654732 12:44655619-44655641 GTTAATGTTTGGAAAACTTCAGG - Intronic
1097440944 12:59607744-59607766 GATAAGGTATGAAAAGCTCTGGG - Intronic
1098700569 12:73619888-73619910 GTTAATATATGTAAAGTATTTGG - Intergenic
1099237885 12:80103777-80103799 GTGAATGTTTGCAAAGGTATAGG - Intergenic
1099877408 12:88425757-88425779 GTTAATGTACGTAAAGCACTTGG + Intergenic
1100014551 12:89993322-89993344 GTTAATTTATGAAAGTCTTTTGG - Intergenic
1100285281 12:93159738-93159760 GTTAACATATGCAAAGCAGTTGG + Intergenic
1101069268 12:101056811-101056833 GTTAATACAGGAAAAGCTTTTGG - Intronic
1101118002 12:101550785-101550807 GTTAATGCATGTAAAGCGTTTGG + Intergenic
1102765897 12:115432841-115432863 GTTAATCCATGTAAAGCATTTGG + Intergenic
1103363098 12:120365387-120365409 GATAATGCATACAAAGCATTTGG + Intronic
1103451853 12:121034773-121034795 AATAATGTATGCCAAGCGTTTGG + Intronic
1104460149 12:128948729-128948751 GTTAAGATCTGCAAACCTTTGGG + Intronic
1106574197 13:30958906-30958928 GTTAATTTATGAAAAGCTAAGGG - Intronic
1107071107 13:36270344-36270366 TTGAATGTATGCATTGCTTTGGG - Intronic
1107926537 13:45268351-45268373 TTTTATTTATACAAAGCTTTAGG + Intronic
1108274381 13:48792728-48792750 TATAATGTATACAAAGCTATTGG + Intergenic
1110877242 13:80525133-80525155 GTTAATGCATGCAAAGTGCTTGG + Intergenic
1111207175 13:85026656-85026678 GATATTGTATGGAAAGCCTTTGG + Intergenic
1111984972 13:95056885-95056907 GTTGATGTATGCCAACCGTTAGG + Intronic
1114815900 14:25957645-25957667 GCTACTGTATGCAAAACTTTAGG + Intergenic
1115469199 14:33750511-33750533 GTAGATGTAAACAAAGCTTTGGG - Intronic
1115509810 14:34128552-34128574 GTTATTTTATGCAAAACCTTTGG - Intronic
1115595707 14:34906861-34906883 GTTAATGTAAGCGAAGGTTATGG + Intergenic
1116614041 14:47111105-47111127 GTTAATGTATGCAAAGCTTTTGG - Intronic
1117806429 14:59496373-59496395 GTTAAGTTATGCAAGGCCTTAGG - Intronic
1119316273 14:73697853-73697875 GTTTATGCATTCAAAGCCTTTGG + Exonic
1119912961 14:78367847-78367869 GATAATGTAAACAAAGCTGTGGG + Intronic
1120469718 14:84907293-84907315 GTAAATTTATGTAAAGCATTTGG - Intergenic
1120761196 14:88287006-88287028 GTTAATGCATGTAAAGCACTTGG - Intronic
1122431168 14:101646475-101646497 GACCATATATGCAAAGCTTTTGG - Intergenic
1125307549 15:38337053-38337075 GTGAATGTTTTAAAAGCTTTTGG + Intronic
1125719816 15:41839923-41839945 GTTAATGTATGCAAAGCCCTTGG + Intronic
1127749052 15:62014682-62014704 GATAGTTTATGTAAAGCTTTTGG - Intronic
1128570939 15:68732418-68732440 TTAAATGTATGTAAAGGTTTAGG + Intergenic
1129984376 15:79904433-79904455 GTTAATGTAAACAAAGCACTTGG - Intronic
1130542178 15:84828179-84828201 GTTAATACATGCAAAGTGTTTGG + Intronic
1131757882 15:95585794-95585816 TTTAATGTATGCAAAAGCTTGGG + Intergenic
1132073111 15:98797228-98797250 GGAAATGCATCCAAAGCTTTGGG + Intronic
1133416150 16:5608581-5608603 GTTAATATAGGTAAAGCCTTAGG + Intergenic
1133463126 16:6004394-6004416 GTTAATATTTGTAAAGATTTAGG + Intergenic
1135667092 16:24345116-24345138 GATAATTTTTGCAAAGCTCTAGG - Intronic
1135928265 16:26714337-26714359 GATGATGCAGGCAAAGCTTTTGG + Intergenic
1137644827 16:50064843-50064865 CTCAATATATGCATAGCTTTGGG - Intergenic
1139240305 16:65384830-65384852 GCTAATGTATGGCAAGTTTTGGG - Intergenic
1139405994 16:66718085-66718107 CTTAAGGTATGAAGAGCTTTAGG - Intergenic
1140103314 16:71937585-71937607 GATCATGTATGCAAAGCTATTGG + Intronic
1141759192 16:86016227-86016249 GTTAATGTCTACAAAACATTAGG - Intergenic
1141768770 16:86075928-86075950 GATAATGTATGTAAAGGGTTTGG - Intergenic
1146140695 17:30365461-30365483 GTTAATGAATGGAAGGCTGTTGG - Intergenic
1146483076 17:33220632-33220654 GTTAATGTATACAAAGCACCCGG + Intronic
1146767304 17:35535008-35535030 GATAATGTATGTAAAGTTTTTGG - Intronic
1147478560 17:40737252-40737274 GATAATGTAGGCAAAAATTTGGG - Intergenic
1148038888 17:44690393-44690415 GATAATGCATGAAAAGCTTTTGG - Intergenic
1148819127 17:50350239-50350261 ATGAATGAATGCAAAGCTTTTGG - Intronic
1149322417 17:55494978-55495000 GGCAATGTATGCAAAGCGCTTGG + Intergenic
1149613267 17:57974483-57974505 GGTGATGTAGGCAAAGCTTGGGG + Exonic
1153015301 18:577620-577642 TTTAATGTGTGCCTAGCTTTGGG - Intergenic
1153718546 18:7876987-7877009 GTTAATATATGTAAAACATTTGG + Intronic
1155518811 18:26649027-26649049 GATAATGAAACCAAAGCTTTGGG + Intronic
1156498122 18:37539197-37539219 GATAATATGTGCAAAGCTCTCGG - Intronic
1157011464 18:43654163-43654185 GTTAATTTTTGCAAAGGTGTAGG - Intergenic
1158271623 18:55722806-55722828 CTTAATGTTGGCAAAGGTTTAGG + Intergenic
1160364852 18:78315048-78315070 ATTAATGTGTGCAAAGCAGTTGG + Intergenic
1160757391 19:764871-764893 GTTAATTTACGTAAAGCTCTCGG + Intergenic
1161971134 19:7581172-7581194 GTTAATGCATGCAATTCTGTGGG + Intergenic
1164015184 19:21249671-21249693 GTTAATCTAGGCCAAGCTTGAGG + Intronic
1165373482 19:35425152-35425174 GTTGATGTATCTAAAACTTTTGG - Intergenic
1165380876 19:35479274-35479296 GATAATATATGCAAAGCACTTGG + Intergenic
1167194353 19:48017003-48017025 GATATTGTATACAAAGCTCTTGG - Intronic
925853132 2:8103494-8103516 GTAAATGTATTCTAAGCTCTTGG + Intergenic
926318713 2:11732558-11732580 GATAATGTCTGCAAAGGGTTTGG + Intronic
926668265 2:15549104-15549126 ATTAATGTATGTAAAACTCTCGG - Intronic
927271927 2:21220339-21220361 GTTAAGGTAAGCAATGATTTAGG + Intergenic
927330062 2:21852064-21852086 GATAATGTATGGAAAACTTCAGG - Intergenic
927424000 2:22960841-22960863 GACAATGTATGCAAAGCACTTGG + Intergenic
928493859 2:31812035-31812057 GTTAATGGATATAAAGCATTTGG + Intergenic
928662187 2:33514113-33514135 AATAATATATGCAAAGCATTCGG + Intronic
930411932 2:51035039-51035061 GTTAATGTAAGTAAAGCACTTGG - Intergenic
931343892 2:61428450-61428472 GTTAATGTAATAAAAGCCTTAGG + Intronic
932477432 2:72015032-72015054 GCAAATGTATGTAAAGCATTTGG - Intergenic
932560304 2:72862212-72862234 GCTAATGTCTGCAAAGTTTGTGG - Intergenic
932909827 2:75793701-75793723 TTTAATTTATGCAAAACTTTTGG - Intergenic
933022569 2:77212757-77212779 GTTAATGTATGCATTACATTAGG + Intronic
934508504 2:94916781-94916803 GTCAAGGTATGCAAGGCTCTTGG + Intergenic
935536935 2:104305792-104305814 GGAAAGGTATGCAAAACTTTCGG + Intergenic
938472462 2:131577412-131577434 CTTAATGAAGGCAAAGTTTTTGG + Intergenic
941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG + Intergenic
941638777 2:167964672-167964694 GTCAATGTTTTTAAAGCTTTGGG + Exonic
941995319 2:171596480-171596502 GTTGATTTTTGCAAACCTTTAGG - Intergenic
942379630 2:175375319-175375341 CTTACTGAAAGCAAAGCTTTAGG - Intergenic
943079853 2:183245770-183245792 ATTAATGCATTCATAGCTTTTGG + Intergenic
943543832 2:189250218-189250240 GTTCATATATCCAAAGCTCTAGG - Intergenic
943585312 2:189732347-189732369 ATTAATTTAAGCAAAACTTTGGG - Intronic
944324640 2:198389602-198389624 GTTGCCATATGCAAAGCTTTAGG - Intronic
944513048 2:200483536-200483558 GTTAATATTTGCAAAGCATTTGG + Intergenic
946113340 2:217439340-217439362 GTTGATATATGCAAAGACTTAGG - Intronic
947018442 2:225647301-225647323 CTTAAGGTATGCAAGGATTTAGG + Intronic
947221109 2:227793168-227793190 AGTAATGGATCCAAAGCTTTGGG + Intergenic
947773758 2:232691400-232691422 GTTAATGCATGCAACATTTTTGG + Intergenic
947820773 2:233067971-233067993 TTTTATGTGTGCAAAGCATTCGG - Intronic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1169588416 20:7113362-7113384 TTTAATGTATTCGAAGGTTTGGG + Intergenic
1174268168 20:49347070-49347092 GTTAATATAGGCAAAGCATCTGG + Intergenic
1174879403 20:54262196-54262218 GTTAATACATGCAAAGCACTTGG - Intergenic
1178612199 21:34093654-34093676 GTTAATGTGTGGAAGGCATTAGG + Intronic
1180680426 22:17622320-17622342 GTGAATGAATGCAAATCTGTTGG + Intronic
1184360800 22:44017293-44017315 GTGAATGAATGCAGTGCTTTGGG + Intronic
1184618498 22:45655026-45655048 GTAAATGTATGTTTAGCTTTTGG + Intergenic
1184936142 22:47723579-47723601 TTCAATGTATTCATAGCTTTAGG - Intergenic
1184940518 22:47761455-47761477 TTTAATGCATGCAAAGCACTTGG - Intergenic
949216729 3:1578988-1579010 TTTACTGTATTCAAAGCTGTTGG + Intergenic
951481410 3:23166078-23166100 ATTAAAGAATGCAAAACTTTTGG - Intergenic
951829837 3:26914363-26914385 GTTAATAAATACAAAGCTTCAGG + Intergenic
952585254 3:34885129-34885151 GTTAGTGTATCCAGGGCTTTGGG - Intergenic
952722635 3:36549099-36549121 CTTGATGTTTGCAACGCTTTTGG - Intergenic
952774022 3:37027461-37027483 GATAACGTATGCAAAGTATTTGG - Intronic
952985958 3:38783590-38783612 GTTAATGTACTCAAAGTTTATGG + Intronic
955244782 3:57214600-57214622 ATTAATATCTGCAAAGCTCTTGG + Intronic
955867104 3:63396797-63396819 GTTAATGTTTTTAAAGTTTTAGG - Intronic
956468952 3:69544810-69544832 GTTAATATGTGGAAAGCATTTGG + Intergenic
957796540 3:85016445-85016467 GTTAAAATATGCAAAGGTATAGG - Intronic
958036466 3:88175442-88175464 GATAATATGTGCAAGGCTTTTGG + Intergenic
960025985 3:113010199-113010221 TTTAATGCATGTAAAGCGTTCGG - Intronic
960246970 3:115410577-115410599 GATAATATATGCAAAGCATTTGG - Intergenic
960955860 3:123030035-123030057 GTTAATCAATACAATGCTTTAGG - Intergenic
961366678 3:126404391-126404413 GTTTATCTAGACAAAGCTTTGGG + Intronic
963974928 3:151469700-151469722 GGTAATTTAGGCAAAGGTTTAGG - Intergenic
964091048 3:152875951-152875973 TTTAATATATGTAAAGCTCTTGG - Intergenic
964780040 3:160327249-160327271 TTTAATGTATACATTGCTTTGGG - Intronic
964850345 3:161089206-161089228 GATAATATATGCAAAACTTCTGG + Intronic
964861536 3:161207839-161207861 GTTAAGGTAGGCTAAGCTTTAGG - Intronic
964878176 3:161393676-161393698 TTTAATGTGTGAAAAACTTTTGG + Intergenic
965133710 3:164735019-164735041 TTTGATGTTTTCAAAGCTTTGGG - Intergenic
965217043 3:165875842-165875864 GGTTATGCATGCAAAGCATTTGG - Intergenic
965372419 3:167879986-167880008 ATTAAAGTTTCCAAAGCTTTTGG + Intergenic
967553337 3:190825602-190825624 ATTAATATATGGTAAGCTTTTGG + Intergenic
970890914 4:21043776-21043798 CATAATGGATGCAAAGCATTTGG - Intronic
970910776 4:21272252-21272274 ATTATTGTATGAAAAGCTCTGGG + Intronic
971177526 4:24293968-24293990 GTTAATTTATATAAAACTTTTGG + Intergenic
971396276 4:26230414-26230436 GTTAATATATGTAAAGCACTTGG - Intronic
971849733 4:31968761-31968783 GTTAATATGTGCAAAGGTCTGGG - Intergenic
973264350 4:48196469-48196491 GTCAATTCATGTAAAGCTTTTGG + Intronic
973839229 4:54844088-54844110 GTGTTTGTATGCAAAACTTTTGG - Intergenic
974355963 4:60813304-60813326 GTTGATGAATGCAAAACTGTTGG - Intergenic
975087704 4:70363430-70363452 GATAATGTATGTAATGCATTTGG - Intronic
975256291 4:72239556-72239578 GCTAAACTAAGCAAAGCTTTTGG - Intergenic
976541236 4:86279516-86279538 GTTAATATATGCAAAGCATATGG + Intronic
976567313 4:86566062-86566084 GTTAATATGTGCAAATCTTTTGG - Intronic
977401012 4:96532588-96532610 GTCAATGTTTACAAAGCTTATGG + Intergenic
977882258 4:102218542-102218564 GTTATTTTATGTTAAGCTTTTGG - Intergenic
978231799 4:106408788-106408810 GTGAATGTTTTCAAAGTTTTGGG - Intergenic
978523875 4:109644833-109644855 CATAATGTATGAATAGCTTTAGG + Intronic
978732903 4:112050878-112050900 GTTAATGTATGTAAATGGTTTGG - Intergenic
978842456 4:113230592-113230614 GTTAATGCATGGAAAGCTTAAGG + Intronic
978978944 4:114917876-114917898 GTTAATGCATAGAAAGCATTTGG + Intronic
979430373 4:120622321-120622343 GTTAATATATGTAAAGCACTTGG - Intergenic
980649379 4:135690368-135690390 GATAATTTATGCAAAGCAATTGG + Intergenic
981021092 4:140029822-140029844 ATAAATCTATCCAAAGCTTTTGG + Intronic
981449603 4:144881000-144881022 GCTAATTTATCCAAAGCTTTTGG - Intergenic
983132583 4:164040637-164040659 TTAAACGTAAGCAAAGCTTTAGG + Intronic
983859512 4:172687708-172687730 GATAATGTTTGCAATGCATTTGG + Intronic
984318032 4:178154662-178154684 ATAAATCTATGCACAGCTTTTGG - Intergenic
987286218 5:16460106-16460128 TTTAAAGTATGCAATGATTTAGG - Intronic
989217059 5:38916513-38916535 GTTAATATATGCAAAACATTTGG + Intronic
989475837 5:41871246-41871268 GTTAATTCATGCAAAGTTTATGG + Intergenic
990190669 5:53256615-53256637 GTCAATGTCTCCAAAGTTTTTGG + Intergenic
991233988 5:64372737-64372759 GTTAAAGCATTCAAACCTTTAGG - Exonic
991896603 5:71407506-71407528 TGTAATGCATGCAATGCTTTAGG + Intergenic
992240262 5:74761832-74761854 GTTAGTGTATGTAATGATTTAGG + Intronic
992494036 5:77274174-77274196 TTTAATGAATGCAAATGTTTAGG + Intronic
992503354 5:77363112-77363134 GTTAATGTATGAAATGCACTTGG - Intronic
993050176 5:82917373-82917395 GTTAATATATATAAAGCTCTTGG + Intergenic
995109574 5:108413865-108413887 GTTAATAGATGCAAAGCTGGTGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996617896 5:125463401-125463423 GTTCCTGTATGCAAAGAATTAGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998706623 5:144769437-144769459 GATAATGTATGTAAATCATTTGG + Intergenic
999115505 5:149160087-149160109 GCTAATGTTTGCTATGCTTTGGG - Intronic
999403603 5:151286767-151286789 GTTAATGTATGTAAATAATTTGG + Intronic
999939677 5:156528299-156528321 GTTAATTTATGTAAAGCTTATGG + Intronic
1000160744 5:158595217-158595239 GTTAATCTATGCAAAGTACTTGG + Intergenic
1000495017 5:161971753-161971775 GTTATTGTATGCAGACCATTGGG + Intergenic
1002842849 6:921233-921255 GTGAATGAATGCAAAGCTGTTGG + Intergenic
1003055212 6:2812174-2812196 GATAATGTATGTAAAGTTTCTGG + Intergenic
1003506540 6:6744944-6744966 GTTAAACTTTGGAAAGCTTTTGG + Intergenic
1004731451 6:18363453-18363475 GCTAATGTATTTAAAGATTTTGG + Intergenic
1004919146 6:20359756-20359778 GTGGATGTGTGCAAAGATTTAGG - Intergenic
1007169015 6:39849458-39849480 GTTAATATTTGTAAAGCATTTGG - Intronic
1009555139 6:65153792-65153814 GTTAATGTAATCACATCTTTAGG + Intronic
1009934871 6:70222254-70222276 GTTAATACATGTAAAGCTCTTGG - Intronic
1011326238 6:86152115-86152137 GTGAATGAATGCAAAACTGTCGG - Intergenic
1011472850 6:87725212-87725234 AATAATGTCTGCAAAGCTTCTGG + Intergenic
1012835606 6:104262493-104262515 TTTAAAATATGCAAAACTTTAGG + Intergenic
1014341261 6:120210408-120210430 TTTAATGTAAACAAATCTTTAGG - Intergenic
1014834406 6:126144573-126144595 TTCATTGTCTGCAAAGCTTTGGG - Intergenic
1015383470 6:132595617-132595639 TTGTATGCATGCAAAGCTTTAGG - Intergenic
1016178878 6:141119308-141119330 GATAATGTGTGCAAAACTCTTGG + Intergenic
1017124309 6:151051407-151051429 GCTAATCTATACAAAGCATTTGG - Intronic
1018147358 6:160904995-160905017 GTTACTGAATGCCCAGCTTTTGG + Intergenic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1020969143 7:14912176-14912198 TCTAAAGTATGCAAAGCTGTTGG + Intronic
1022181305 7:27923249-27923271 GGTAATGTCTGCAAGGGTTTGGG + Intronic
1022527294 7:31046582-31046604 TTGAATGTATGCAAGGCCTTGGG + Intergenic
1023282216 7:38582446-38582468 GTTGATGCATGGAAAGCTCTTGG - Intronic
1026361584 7:69605807-69605829 CTGAAAGTATGCATAGCTTTAGG + Intronic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1028683922 7:93571444-93571466 GTTAATATTTGTAAAGCATTTGG - Intronic
1030468807 7:109937639-109937661 GTTAATGAATCCAAATATTTTGG - Intergenic
1030663349 7:112246771-112246793 CTTACTGTATGCCAAGCATTTGG - Intronic
1030872336 7:114772361-114772383 GCTAATGTATCCCAAACTTTTGG - Intergenic
1031541622 7:123001983-123002005 GTTCATGTATTCACAGGTTTGGG - Intergenic
1033993465 7:147316236-147316258 ACTAATGTAGGCAAAGATTTGGG + Intronic
1034216841 7:149414151-149414173 ATTAATGGAACCAAAGCTTTTGG + Intergenic
1034992015 7:155553834-155553856 GTGGATGAATTCAAAGCTTTTGG + Intergenic
1035939297 8:3877931-3877953 CTTGATGTAGACAAAGCTTTAGG - Intronic
1037071981 8:14662007-14662029 GTTAATTTTAGCAAATCTTTTGG - Intronic
1037301979 8:17461369-17461391 GTTAATGGTTGCCAAGGTTTAGG + Intergenic
1037369337 8:18157709-18157731 GCTAATTTATTAAAAGCTTTTGG + Intergenic
1039599683 8:38824985-38825007 TCTACTGTCTGCAAAGCTTTTGG + Intronic
1040142407 8:43937865-43937887 GTGGATGTTTACAAAGCTTTGGG + Intergenic
1040184696 8:44617969-44617991 GTGGATGTTTACAAAGCTTTGGG + Intergenic
1041242618 8:55861278-55861300 GATAATGTATGCAAATACTTGGG + Intergenic
1041565004 8:59267120-59267142 GTTACTGTAAGCAAAGCATGTGG + Intergenic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1042367585 8:67954511-67954533 TTTAATCTATGCAAACCCTTTGG + Intronic
1042609282 8:70579258-70579280 GTTACTGTATGGAATACTTTAGG + Intronic
1042886832 8:73561804-73561826 ACTAATATATGCAAAGCATTTGG - Intronic
1043590555 8:81828252-81828274 GTTAAATTATGCAAAACTTTTGG + Intronic
1044358267 8:91251613-91251635 GATAATGTATGTAAGGGTTTAGG - Intronic
1044398154 8:91738385-91738407 GATAATGTATGTAAAGAGTTTGG - Intergenic
1044457172 8:92401853-92401875 GTTAATATAGGTAAAACTTTAGG + Intergenic
1044571050 8:93719447-93719469 GAAAATGCATGTAAAGCTTTGGG - Intronic
1044946087 8:97391422-97391444 GATAATTTATGCAAAGCACTCGG - Intergenic
1044995955 8:97838440-97838462 GTTAATCTATGTAAAGCACTCGG - Intronic
1047552707 8:125893939-125893961 ATTAATGTATGCATTGTTTTAGG + Intergenic
1048400773 8:134067281-134067303 GATAATATAGGCAAAGCATTTGG - Intergenic
1050698870 9:8313845-8313867 GTTAATTTATTCATACCTTTGGG - Intergenic
1051208592 9:14716453-14716475 GATAATGTATGCAAATTTTAAGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1051414717 9:16826979-16827001 GTTAATGTATGTAACTTTTTTGG + Intronic
1051510984 9:17877713-17877735 ATTAATATATGCAAAACTCTTGG - Intergenic
1052066790 9:24032015-24032037 ATTAATGTATTCAGATCTTTTGG + Intergenic
1052632125 9:31055108-31055130 GATAATGAATTCAAAGGTTTAGG - Intergenic
1053535136 9:38917987-38918009 GTTAATGAATGGAAAACATTAGG + Intergenic
1054207360 9:62142394-62142416 GTTAATGAATGGAAAACATTAGG + Intergenic
1054630993 9:67445960-67445982 GTTAATGAATGGAAAACATTAGG - Intergenic
1056028294 9:82524292-82524314 GTTAAGATATGGAAATCTTTGGG + Intergenic
1056943608 9:90975659-90975681 GTTAATGAATGCAGAGCATGGGG + Intergenic
1057234458 9:93347571-93347593 GTTAATGTATGAAAAGCGTCAGG + Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1057814287 9:98282993-98283015 GTAAATGTAACCAAAGGTTTAGG + Intergenic
1058936076 9:109770863-109770885 GATAATGTATACAAAGCTCCTGG - Intronic
1059711660 9:116873233-116873255 GATAATGTAGGTAAAGCATTAGG + Intronic
1060107062 9:120879152-120879174 GTTAATGTATGCAAAGCCCCTGG + Intronic
1060353187 9:122877942-122877964 GTTTAAGTAGACAAAGCTTTTGG - Intronic
1060382250 9:123187052-123187074 GTTAATATATGAAAAGTCTTAGG - Intronic
1060804584 9:126566513-126566535 GATAATGTATGTAAAGTGTTTGG - Intergenic
1186630465 X:11343110-11343132 GTTAATGTATCCAAAGCTAAGGG + Intronic
1188103659 X:26122372-26122394 AATAATGTATGTTAAGCTTTAGG + Intergenic
1188125450 X:26362641-26362663 GGTAAAATATACAAAGCTTTGGG + Intergenic
1188440671 X:30212960-30212982 GTTAATGTATGTAAAGCACCTGG - Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1189601085 X:42626971-42626993 GTGAATGTATGCTAATCATTAGG - Intergenic
1189642630 X:43089211-43089233 GATAATGGATGAAAAGCTCTCGG + Intergenic
1189842375 X:45094174-45094196 CTTATTGTATGCAAGGCTCTAGG + Intronic
1190909757 X:54759827-54759849 GTTAATGTTTGGAAAGCTGGAGG - Exonic
1191898517 X:66018252-66018274 GATAATGCATGTAAAGCCTTTGG - Intergenic
1192205903 X:69095840-69095862 GTGAATACATGCAAAGCATTTGG - Intergenic
1192718779 X:73669957-73669979 GTCAGAGTATGCAAAGCTCTTGG + Intronic
1192960609 X:76126867-76126889 GCTGGTGTATGCAAAACTTTTGG - Intergenic
1195918030 X:109955010-109955032 ATTAATGTATGTAAAGTATTTGG + Intergenic
1196025565 X:111038117-111038139 AATAATGTATGCAAAGCATCAGG + Intronic
1196717087 X:118822665-118822687 GAAATTGTATGCAAAGATTTCGG - Intergenic
1196771975 X:119303365-119303387 GTTAAAGTTTGAAAAGCATTGGG + Intergenic
1197290160 X:124646144-124646166 TTTAATTTTTGAAAAGCTTTAGG - Intronic
1197440236 X:126478628-126478650 GTTATTGTTTGCAAACCTCTTGG + Intergenic
1197702982 X:129613642-129613664 GTTAATAGATGCAAAGTGTTTGG - Intergenic