ID: 1116614759

View in Genome Browser
Species Human (GRCh38)
Location 14:47120514-47120536
Sequence CTTCTGTTCCTGAAGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116614759_1116614760 25 Left 1116614759 14:47120514-47120536 CCTATTTTCTTCAGGAACAGAAG 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1116614760 14:47120562-47120584 CAAGAAAAAAATAAATATAAAGG 0: 1
1: 3
2: 34
3: 552
4: 8791
1116614759_1116614761 28 Left 1116614759 14:47120514-47120536 CCTATTTTCTTCAGGAACAGAAG 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1116614761 14:47120565-47120587 GAAAAAAATAAATATAAAGGTGG 0: 1
1: 2
2: 21
3: 368
4: 5325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116614759 Original CRISPR CTTCTGTTCCTGAAGAAAAT AGG (reversed) Intronic
901134753 1:6985982-6986004 CTTCCGTGCCTGAAGGAAACAGG - Intronic
901328196 1:8382348-8382370 CACCTGGTCCTGAAGAAATTGGG - Intronic
902358866 1:15930604-15930626 CTTCATCTCGTGAAGAAAATTGG + Exonic
902960537 1:19960074-19960096 CTTCTGTTCATATAGGAAATCGG + Intergenic
903784990 1:25854677-25854699 CTTCTGTGCATGAAGAATTTGGG + Intronic
903820265 1:26096598-26096620 GTTCTGTTCCTGGAGAAAAAGGG - Intergenic
904663988 1:32106012-32106034 TTTCTTTGCCTCAAGAAAATGGG + Intergenic
904828793 1:33293622-33293644 CTTCTGTTCCTCAACAAATTAGG + Intronic
904990569 1:34589477-34589499 CAAACGTTCCTGAAGAAAATTGG + Intergenic
908294218 1:62697332-62697354 CTACTGTTCCTAAAGAACACTGG - Intergenic
908613472 1:65889360-65889382 TCTCTGTTCCTCAAGAATATTGG + Intronic
908659133 1:66419168-66419190 CTCCTGTTCCTGCAAAAAACTGG - Intergenic
908814593 1:68018699-68018721 CTTCTGTTCCTGAAGCATTGTGG + Intergenic
909497813 1:76298974-76298996 CTTTTCTTCCTGAGTAAAATAGG - Intronic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910630282 1:89346718-89346740 TTTCTGTCCCTGAAGGACATTGG + Intergenic
911427686 1:97741092-97741114 CCTCTGCTGCTGAAGAGAATGGG + Intronic
911630432 1:100177481-100177503 ATTCTGTTCCTGAGTAAATTCGG - Intronic
911817835 1:102376253-102376275 CCTCTGTTGTTGAATAAAATAGG + Intergenic
912531475 1:110326909-110326931 TTTCTTTTTCTGAAGAAAAAGGG + Intergenic
913595116 1:120368035-120368057 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914092155 1:144510951-144510973 CTTGGATTCCTGAGGAAAATAGG + Intergenic
914306379 1:146422914-146422936 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914424337 1:147561001-147561023 CTTCTATTTATGTAGAAAATGGG - Intronic
914595669 1:149149888-149149910 CTTGGATTCCTGAGGAAAATAGG + Intergenic
916720467 1:167481737-167481759 CTGCTTTTCCTGGAGGAAATGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917657101 1:177137318-177137340 CATCTCTTCTTGAAGAGAATAGG + Intronic
917875524 1:179283288-179283310 ATTCTGTTACTAAAGAAAAAGGG + Intergenic
918123879 1:181565429-181565451 TTTCTCTTCCAGAAGAAAACTGG - Intronic
918553396 1:185770495-185770517 TTTCTTGTCCTGAAGAAAAATGG + Intronic
919962655 1:202487276-202487298 CTTCTGTTCCTATAGAAAATAGG - Intronic
921506708 1:215979858-215979880 CTTCTGTTCCTGGTTAAAAAGGG + Intronic
922122377 1:222685314-222685336 CTTCTGTTTCTTTATAAAATGGG - Intronic
922679283 1:227578353-227578375 CTGGTGTCCCTGAAGGAAATGGG - Intronic
923296051 1:232595835-232595857 CATCTATTCCTAATGAAAATAGG - Intergenic
923920017 1:238553377-238553399 CTTCTCTTTATGAAGTAAATAGG + Intergenic
924629032 1:245719928-245719950 CTTCTGTTCCTGGTGACACTTGG + Intergenic
1063225422 10:4011005-4011027 CAACTCTTCCTAAAGAAAATTGG + Intergenic
1063808103 10:9670926-9670948 CCTCTGTTAATGCAGAAAATGGG - Intergenic
1064047693 10:12032823-12032845 CTTCTGTTCCTTATTAAAAGAGG + Intronic
1065747217 10:28853510-28853532 CTTCTGGTCCTGAAGGAGAAAGG - Intronic
1065814455 10:29471441-29471463 CTTCTTTTCCTAAACAAAATAGG + Intronic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1067463877 10:46479363-46479385 CTTATTTTTCTGAAGAAAATAGG + Intergenic
1067623318 10:47905288-47905310 CTTATTTTTCTGAAGAAAATAGG - Intergenic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068463799 10:57360804-57360826 GATCTGTTCCTGAGGAAAATAGG - Intergenic
1069595239 10:69665975-69665997 CATCTGCTCCTTAAGAAAAATGG + Intergenic
1071415285 10:85435627-85435649 CTCCAGTTCATGAAGAAAGTGGG + Intergenic
1072729926 10:97839031-97839053 CTTCTGTCACTGAAGAAAACAGG + Intergenic
1073307888 10:102517400-102517422 CTTCTCTTCCTCAAGAGACTTGG + Intronic
1074664765 10:115708349-115708371 CTTCTTTTCCCTGAGAAAATTGG + Intronic
1074665945 10:115724359-115724381 TCACTGTTGCTGAAGAAAATGGG + Intronic
1075867555 10:125739199-125739221 CTTCTTTTCCTGAACAAACATGG + Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1078516264 11:12025234-12025256 TTTCTGTACCTGATGAAATTTGG + Intergenic
1079019531 11:16897708-16897730 TTTGTGTTCCTGAAGCAAAATGG - Intronic
1080660120 11:34289044-34289066 CCTCTGCTCTTGAAGAAAGTGGG + Intronic
1081045462 11:38268675-38268697 CTTCTATGCCTGAAGAAAAGGGG - Intergenic
1083443201 11:62690357-62690379 CTCTAGTTCCTGAAGAAAAGGGG - Exonic
1084470897 11:69358460-69358482 GTTCTTTCCTTGAAGAAAATGGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086599550 11:88616061-88616083 TTTCTGTGCCTGAAAAAAAATGG + Intronic
1087908975 11:103730651-103730673 CTTTTTTTCATGTAGAAAATGGG - Intergenic
1088024237 11:105158285-105158307 GTTCTGTTACTGTAGAAAAACGG + Intergenic
1089813016 11:121147280-121147302 CTCCTTTTCCAGATGAAAATGGG - Intronic
1089917153 11:122169048-122169070 CTTCTGTATCTGAAGACAAAAGG - Intergenic
1092891305 12:12971652-12971674 CTTCTGTTTCTTCATAAAATGGG + Intergenic
1092905851 12:13100249-13100271 CTTCTGTTGCTAAAGGAAACAGG + Intronic
1093242617 12:16696939-16696961 GTTCTATTCATGAAGACAATGGG + Intergenic
1093863719 12:24199231-24199253 CGTCTGTTCCAGAATAAGATAGG + Intergenic
1096999207 12:55862153-55862175 CTTCAATTCCTGAAAACAATTGG + Intergenic
1098077148 12:66744262-66744284 CTTCTATTCCTGAAAAAAAAAGG + Intronic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1098937020 12:76491631-76491653 CCTCTGTCCTTGAAGAGAATTGG - Intronic
1099307528 12:80976548-80976570 GTTTCGTTCTTGAAGAAAATTGG - Intronic
1099918404 12:88925435-88925457 CATTTGTTACTAAAGAAAATTGG + Intergenic
1100595346 12:96066817-96066839 CTACTTTGCCTGAAAAAAATGGG - Intergenic
1101267516 12:103104740-103104762 TTTCTGTTCCTGAATAAACATGG - Intergenic
1101391095 12:104301260-104301282 CCTCTGAGCCAGAAGAAAATAGG + Intronic
1102560910 12:113761851-113761873 CTTCTGGTCCTAAGGAAAATGGG - Intergenic
1103081999 12:118031597-118031619 CTTCTGTTCCAGACCAAAATGGG - Exonic
1105342982 13:19545384-19545406 CCTCCATTCCTGAAGAAGATGGG + Intergenic
1106815420 13:33402318-33402340 CTTCTGTTCTTGATAAAATTAGG + Intergenic
1108443479 13:50480701-50480723 GTTCTATTCCTTAAGAAATTAGG + Intronic
1109708165 13:66127170-66127192 CTTCTGTTCCTCAAGAATGGAGG + Intergenic
1115056781 14:29137553-29137575 TCTATGTTCCTGAAGAACATGGG + Intergenic
1115271426 14:31557744-31557766 CTTCCTTTCCTGAATAAAAAAGG + Intronic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117875310 14:60245850-60245872 GTTCTGTTCTGGGAGAAAATGGG + Exonic
1118087369 14:62433184-62433206 CTTTGCTTCCTGGAGAAAATTGG - Intergenic
1118573687 14:67219909-67219931 ATTATGTTCCTGATGCAAATAGG - Intronic
1118831065 14:69433364-69433386 TTTCTGTTCATGAAGAATACTGG + Intronic
1119914569 14:78385570-78385592 CTTCTGTCCCTGGAGAAATAAGG - Intronic
1119936252 14:78594757-78594779 CTCCTGTTCCAGGAGAAAACTGG + Intronic
1120008654 14:79388496-79388518 CTTGGGTTCCTAAGGAAAATAGG - Intronic
1120019069 14:79507802-79507824 CTTCATTCCCTAAAGAAAATGGG + Intronic
1120557059 14:85940564-85940586 CTTCTGTTCTTAAAGGATATTGG + Intergenic
1121508035 14:94491378-94491400 TTTTTTTTCCTGAATAAAATGGG + Intronic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1124399322 15:29334650-29334672 CTTCTCCTCCTGAAGGAAAGTGG + Intronic
1124939191 15:34202326-34202348 CTTCTGGTACTGTAGAAATTAGG - Intronic
1127567664 15:60208693-60208715 CTTTTTTCCCTGTAGAAAATGGG - Intergenic
1127570158 15:60233929-60233951 CTTTTGATGCTGAAGAAATTGGG + Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1130214345 15:81954051-81954073 ATCCTGTTCCTGGAGGAAATCGG + Intergenic
1131898174 15:97056804-97056826 TTTCTCTTCCTTAAAAAAATTGG - Intergenic
1132057349 15:98662378-98662400 TCTCTGTGCCTGAAGAGAATGGG + Intronic
1137259806 16:46816670-46816692 ATTCTGTTCTTAAAGAAGATGGG - Intronic
1138112385 16:54334628-54334650 CAACTGTTCCTGTAGAAGATGGG - Intergenic
1139024111 16:62792501-62792523 CTTATGTTCATCAGGAAAATTGG + Intergenic
1139261869 16:65601899-65601921 CTTTTGTGGCTGAAGAAAAGTGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143502587 17:7347839-7347861 CTGCTGCTCCTGAAGACACTGGG - Intronic
1144516374 17:15919875-15919897 CCTTTGTTCATGAAGAAATTGGG + Intergenic
1146448284 17:32950962-32950984 CTTCTATTCCTTAAGATAAAAGG - Intergenic
1146964485 17:37013470-37013492 CTTCTGTTCATGAAGGAAGGCGG + Intronic
1148097828 17:45066017-45066039 CTTTAGTTCCTGAAAAAAAGGGG - Intronic
1149446350 17:56716223-56716245 CTTCTCTTAGGGAAGAAAATAGG - Intergenic
1150091306 17:62328033-62328055 CTTTTGTTCCTTAAGAAATAAGG - Intergenic
1152310760 17:79548329-79548351 CTTCTGTTCCAGGAGCACATGGG - Intergenic
1152572956 17:81128489-81128511 CTCCTGTACCTGAAGGAAATCGG - Exonic
1153723165 18:7928058-7928080 CTTCTCTTTCTGGGGAAAATGGG + Intronic
1156009970 18:32485830-32485852 CTTGTGTGCCTGCAGAAATTAGG + Intergenic
1156073020 18:33236819-33236841 CTCCTGTTCCTGAATCAGATGGG + Intronic
1156536709 18:37871375-37871397 CTTCTGTTCTTGATGCAACTGGG - Intergenic
1156650838 18:39225560-39225582 CTTCTGTTCCTGATGACTGTTGG - Intergenic
1157734649 18:50036248-50036270 CATCTGTTTCTTCAGAAAATGGG - Intronic
1158435427 18:57432318-57432340 TTTCTGATCTTCAAGAAAATTGG + Intergenic
1158926564 18:62270070-62270092 CTTCTGTTGCTGCAGTAAGTGGG + Intronic
1162533984 19:11252543-11252565 CTTCTTTTGCTGCAGAAAACTGG - Exonic
1166027493 19:40101161-40101183 GTTTTATTCCTCAAGAAAATTGG - Intergenic
1167313309 19:48750074-48750096 GTGGTGTTCCTGAAGCAAATGGG - Exonic
1168274629 19:55270562-55270584 CTACTGTTGCTTAAGAAAAAAGG + Intronic
926035619 2:9633072-9633094 CTTCTGTGCCTGAAAGAACTCGG + Intergenic
926467567 2:13210029-13210051 CTTTTTTTCCTGAATAAATTTGG - Intergenic
926493968 2:13560738-13560760 CTTCTGTTTCCCAAGAAATTAGG + Intergenic
928284031 2:29973381-29973403 CTCGTGTTCCTAGAGAAAATTGG - Intergenic
930417424 2:51106258-51106280 ATTCTCTTCTTGAACAAAATTGG + Intergenic
931584833 2:63814009-63814031 CTTCTGTTTCTGAACAAATGAGG + Intronic
932684490 2:73856713-73856735 CTCCTGTTCTTGAACCAAATTGG - Intronic
933099505 2:78234895-78234917 CTTATGTTTCTGAAAACAATGGG + Intergenic
933401263 2:81799077-81799099 CTCCTGTTTCTAAAGAAAATAGG + Intergenic
934570549 2:95369385-95369407 CCTGTGTTCATGAAGAATATTGG + Intronic
935391744 2:102559993-102560015 CTTCTCTTACTAAACAAAATAGG - Intergenic
935526580 2:104177155-104177177 CTTCAGTTCATGAGGAATATTGG + Intergenic
935741213 2:106150351-106150373 GTTCTGTCCCTTAAGACAATGGG + Intronic
935825353 2:106942447-106942469 TTTTTTTTCCTGAAGAAAAGAGG - Intergenic
936644162 2:114349413-114349435 GTTCTGTTCATCAAGACAATAGG - Intergenic
937468685 2:122156747-122156769 CTTCTCTTTTTGAAGATAATTGG + Intergenic
940134746 2:150423592-150423614 CATCTCTTCCTGAAGACACTTGG - Intergenic
940230760 2:151448910-151448932 GTTCTTTTCCAGAAGAAACTTGG + Intronic
940783302 2:157956126-157956148 CTTTTGTTCCTGGTTAAAATTGG - Intronic
941826948 2:169909320-169909342 ATTCTGTTCCTGGAGAAGACTGG + Intronic
943406016 2:187486681-187486703 TTTATTTACCTGAAGAAAATGGG - Intronic
943420148 2:187659298-187659320 CTTCTCTTCCTGTGGAAACTGGG + Intergenic
943588835 2:189773028-189773050 CTTCCTTTACTGAACAAAATAGG + Intronic
943720356 2:191197795-191197817 CTTTTGTGTCTGAAGCAAATGGG + Intergenic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944313230 2:198258571-198258593 TTTCTGTTTCTGATGGAAATGGG + Intronic
945571906 2:211478815-211478837 GTTTTGTTTCTGAAGAAAAAAGG - Intronic
945724922 2:213464079-213464101 TTTCCGTTCCTGCAGGAAATGGG + Intronic
946572226 2:221036712-221036734 GTTCTGTTCCTGTATAAATTTGG + Intergenic
946601569 2:221365477-221365499 CTTCTGTTGCTGCAGTAAAATGG - Intergenic
946727244 2:222672587-222672609 GTTCTGCTCTTGAAGTAAATAGG + Intronic
947984586 2:234437594-234437616 CTTATGGTCCTGAAAGAAATGGG - Intergenic
948467559 2:238159455-238159477 CTTCTGTCCCAAAAGAAAAGGGG - Intronic
1169245044 20:4018479-4018501 CTTTTGTTCTTGAAAAAATTAGG + Intergenic
1169582620 20:7041213-7041235 CTTCAGAACCTGATGAAAATTGG - Intergenic
1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG + Intergenic
1172826343 20:37790267-37790289 CTTTTGTTCCTAATGAACATCGG + Intronic
1173663428 20:44749885-44749907 ATTCAGTTGCTGAAAAAAATTGG + Intronic
1176950390 21:15038456-15038478 CTTCTGTTTCTGTAAAATATAGG - Intronic
1177315230 21:19451745-19451767 TTTCTGTGCATTAAGAAAATTGG + Intergenic
1178191670 21:30289246-30289268 CTGCTGTGCATGAAGGAAATAGG + Exonic
1184910581 22:47531347-47531369 ATTGTGTTCCTGACAAAAATGGG + Intergenic
949111467 3:266224-266246 CCTCTGTTCCTAAAGGAACTTGG + Intronic
950369497 3:12516756-12516778 CTACTCTTACTGAATAAAATAGG + Intronic
952103026 3:30036942-30036964 CTTTTGTTTCTGGAGAAAATTGG + Intergenic
952862042 3:37821092-37821114 CTTCTCTTCCTGGTGAACATGGG + Exonic
952902910 3:38121518-38121540 CTGATGCTCCTGAAGAAAACGGG - Intronic
953168591 3:40487328-40487350 CTTCTGATGCTGAAGAAGGTGGG - Exonic
959129590 3:102337969-102337991 ATCCTGTTTCTCAAGAAAATTGG - Intronic
959567866 3:107851056-107851078 CTTCTACTTCTGTAGAAAATTGG + Intergenic
961062891 3:123846873-123846895 CTTTTGTTACTGCTGAAAATGGG + Intronic
961520950 3:127467150-127467172 CCTCTGTGCCTGAAGACAAGGGG - Intergenic
962991593 3:140582409-140582431 GTTCTGTTCTTGAAAATAATGGG + Intergenic
963376586 3:144474101-144474123 CTTGTTTGCCTGAAGAAATTAGG + Intergenic
965157751 3:165086746-165086768 CTTGTGTTCTTGAAGCAGATGGG + Intergenic
965396577 3:168166450-168166472 CTTTTGTGCCTGTAGAAAATGGG - Intergenic
965729521 3:171755931-171755953 GTTTTCTTCTTGAAGAAAATTGG + Intronic
966014572 3:175125672-175125694 CTTCTATTCTTGTACAAAATAGG - Intronic
967177013 3:186870087-186870109 TTTTTATTACTGAAGAAAATGGG - Intergenic
967563817 3:190950260-190950282 CGTCTCTTCATGGAGAAAATGGG + Intergenic
967900915 3:194451488-194451510 CTGCTGTTGCTGAATATAATGGG - Intronic
968166453 3:196469850-196469872 CTGCTATTCCAGAAAAAAATGGG - Exonic
969037112 4:4263388-4263410 CTTCCCTTGTTGAAGAAAATTGG - Intergenic
971427206 4:26528213-26528235 GTTATTTTCCTCAAGAAAATAGG - Intergenic
971513108 4:27452316-27452338 CTTCTGCACCTGGAGGAAATGGG + Intergenic
972249371 4:37283626-37283648 CTTGTATTTCTGAAAAAAATGGG + Intronic
972845846 4:42988210-42988232 GTTTTGTCCCTGGAGAAAATAGG + Intronic
973113417 4:46424160-46424182 CTTCTGCTACTGCATAAAATAGG - Intronic
973334485 4:48942315-48942337 ATTCTGATGCTCAAGAAAATTGG - Intergenic
973627290 4:52785463-52785485 CATCTGTCCATGAAGAAAGTGGG + Intergenic
975581444 4:75910484-75910506 CTTGTTTTCAGGAAGAAAATGGG + Intergenic
975730830 4:77335638-77335660 CTTCTCTTCCTGATGAAGGTGGG + Intronic
976276128 4:83280374-83280396 GTTCAGATCCTGAAGAAAAATGG + Intronic
977110709 4:92950569-92950591 CTTCAGTCCCAGAAGAAACTGGG + Intronic
977468831 4:97416025-97416047 CTTCTATTTCTGCAAAAAATAGG + Intronic
978071333 4:104475441-104475463 CCATTGTTCCTGATGAAAATTGG - Intronic
978874396 4:113621381-113621403 ATTCTTTTTCTGATGAAAATTGG + Intronic
979409551 4:120359808-120359830 CTTATGTTGCTGAAGTAATTTGG + Intergenic
980576835 4:134693910-134693932 CTTCTATGCCTGAAGAAAGAGGG - Intergenic
981851524 4:149235879-149235901 CTTGTGTTCATGAAAAAGATTGG + Intergenic
982067312 4:151665740-151665762 ATTCTGGTCCTAAAGTAAATCGG + Intergenic
982773909 4:159422904-159422926 AGTCTTTTGCTGAAGAAAATAGG + Intergenic
983107509 4:163707558-163707580 CTTCTGTTGCTGATGGCAATAGG + Intronic
983822957 4:172219227-172219249 CTTCTGTTCTTAAAAAATATAGG + Intronic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
985013285 4:185606353-185606375 TTTATGGTCCTGAAGAAAAATGG + Intronic
987803858 5:22735692-22735714 CATCTATTCCTGTAAAAAATAGG + Intronic
989631727 5:43490630-43490652 CTTCTGTTCTCCAAGAAAATTGG - Exonic
991121014 5:63013651-63013673 CTTCTGTTCTTGTAGATCATAGG + Intergenic
991166461 5:63569260-63569282 TTTCAGTTCCTGTTGAAAATGGG - Intergenic
992149831 5:73892038-73892060 CTTCTGATCCTACATAAAATAGG - Exonic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
993511661 5:88778386-88778408 CTTCTGCATCTGAAGAATATAGG - Intronic
993623228 5:90192526-90192548 CTTCTGGGCCTCAAAAAAATTGG + Intergenic
993650396 5:90513577-90513599 CTTGTATTCATGCAGAAAATTGG + Exonic
994321971 5:98404692-98404714 GCTCTATTCCTGCAGAAAATTGG + Intergenic
994888280 5:105595284-105595306 CTTCTGTTCTTCAAAAATATAGG - Intergenic
996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG + Intronic
996588369 5:125117532-125117554 CTACTGTTCTTGAAGATCATTGG - Intergenic
996819640 5:127612297-127612319 CTGATGTTCCTTAAGAAAAGGGG - Intergenic
1000132797 5:158316109-158316131 CTTATTTCACTGAAGAAAATGGG - Intergenic
1001526028 5:172429541-172429563 CTTCTGTTCCTGGTGAAACTGGG - Intronic
1002109335 5:176897723-176897745 TTTCTGTTCCTTCAGACAATGGG + Intronic
1005347257 6:24902796-24902818 CTTCTCCTCCTGCAGAACATTGG - Intronic
1005379109 6:25215944-25215966 CTCCTATTCCTGAGGCAAATAGG - Intergenic
1006797104 6:36738794-36738816 CTTCTCTTCCTGAAGCACCTGGG + Intergenic
1007817603 6:44535546-44535568 CTGCTGTAGCTGAAGGAAATGGG + Intergenic
1007893883 6:45327158-45327180 ATTCTGATTCAGAAGAAAATTGG - Intronic
1008008269 6:46435703-46435725 CATCAGTTCCTAAAGAAAACTGG - Intronic
1008213154 6:48750825-48750847 GTTCTGTTACTGAATAAACTAGG + Intergenic
1008521296 6:52363673-52363695 CTCCTGTTACTGAAGTTAATAGG + Intronic
1008906814 6:56686813-56686835 CTTCTGTTTCTGGAGAAAAGAGG - Intronic
1009336752 6:62500255-62500277 TTTATTTCCCTGAAGAAAATGGG - Intergenic
1010123507 6:72406936-72406958 CCTCTGCTCCTGGAGAAATTGGG - Intergenic
1010446203 6:75951313-75951335 CTACTGGGCCTGAATAAAATGGG - Intronic
1013340677 6:109212462-109212484 CTTATGGACCAGAAGAAAATAGG - Intergenic
1013942723 6:115684293-115684315 CTAATGTTCTTGAAGAAGATAGG - Intergenic
1015261726 6:131245522-131245544 ATTCTGGGCCTGAAGAAAATCGG - Intronic
1016119293 6:140327592-140327614 TTTCAGTTCTTGTAGAAAATGGG + Intergenic
1018342621 6:162867782-162867804 CTTCTCTTGCTGGAGAAAACCGG - Intronic
1018695350 6:166386718-166386740 ATTCTGTTCTTGACAAAAATTGG - Intergenic
1020982111 7:15083638-15083660 CTTTTCTTCCTTATGAAAATAGG + Intergenic
1021103244 7:16607820-16607842 CTTCTGTTACTGAGGAAGCTGGG - Intronic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023704870 7:42931289-42931311 TTACTGATCCTTAAGAAAATGGG + Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1027934771 7:84588637-84588659 CCTGTGTTCCTGGAGAAAGTTGG + Intergenic
1028858022 7:95614059-95614081 CTTGTGTCCCTGAAGGAGATGGG + Intergenic
1028876109 7:95825089-95825111 TTTCTGTTACTGAATAACATAGG + Intronic
1029812599 7:103064445-103064467 CATCTGCTCCTGGAGAACATGGG + Intronic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1030469159 7:109940940-109940962 CTTCATTTCCTGAATAAAATAGG + Intergenic
1031025842 7:116678902-116678924 TTTTTGTTCCAGAAAAAAATAGG + Intronic
1031348671 7:120701288-120701310 GTTCTGTTACTAAGGAAAATAGG + Intronic
1031458420 7:122013140-122013162 ATTCTGTTCCTATAGGAAATGGG + Exonic
1032511143 7:132473333-132473355 CTCCTGTTCCTGGAGCAAAGAGG + Intronic
1032826748 7:135577600-135577622 CTTAAGTTCCTTAAGAAATTGGG - Intronic
1034062879 7:148109268-148109290 ATTCTGTTCCTGGACCAAATAGG + Intronic
1034452953 7:151147485-151147507 CTTCTGTTACAGAATAAGATTGG - Intergenic
1034855965 7:154547567-154547589 CTTTTGTTCCTGAACTAAAAGGG - Intronic
1036606549 8:10310649-10310671 TTTCTGTTCCTCTACAAAATGGG - Intronic
1037838448 8:22228136-22228158 CTTCTGTTCCTGAAGGAGGCCGG - Intronic
1037931402 8:22882508-22882530 CCTCTGTTCATGATCAAAATAGG - Intronic
1038124893 8:24662532-24662554 CTTTTGGTCCTGAGGAAAGTGGG - Intergenic
1041941816 8:63397087-63397109 CTTGTGTTCCTGACTATAATAGG - Intergenic
1042614652 8:70634973-70634995 CTTCTATTCTTGGAGGAAATTGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1046274502 8:111939702-111939724 CTGCTATACCTGAATAAAATTGG - Intergenic
1046427901 8:114079517-114079539 TTTCTTTTCCTGAAGAAGAATGG - Intergenic
1047638098 8:126788533-126788555 ATTATGTTCTTGAAGAATATCGG + Intergenic
1053491777 9:38512175-38512197 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055935692 9:81602332-81602354 CTTCTGGTCCTGAAGCATTTTGG - Intronic
1056142445 9:83696521-83696543 CTTCAGCTTCTGAAGAAACTGGG - Intronic
1056505169 9:87251519-87251541 CCTCTGCTCCAGCAGAAAATGGG - Intergenic
1057672074 9:97101377-97101399 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1057813631 9:98277924-98277946 CTTCTTTTACTTAAGATAATGGG - Intergenic
1059399026 9:114057234-114057256 CTTCTATTCCAGAAGAACATTGG - Intergenic
1059594323 9:115701089-115701111 CTTGTGTTCATGAAGAATGTTGG - Intergenic
1059776572 9:117481817-117481839 CTCCTCTTCCTGAAGAAATCAGG - Intergenic
1062246519 9:135570571-135570593 CTTCGGTTACTAAAGAAGATTGG + Intergenic
1185766488 X:2729841-2729863 CTTTTGTTCTTGAAGAATCTAGG - Intronic
1186412386 X:9355308-9355330 CTTCTGTTCCTAAAACAAGTAGG + Intergenic
1186548589 X:10478016-10478038 CTTCTGTTCCTCACTACAATAGG - Intronic
1188459489 X:30407222-30407244 CTTCTGTTGCCCTAGAAAATGGG - Intergenic
1189122726 X:38412342-38412364 ATTCAGTTCCTGTATAAAATGGG + Intronic
1190553052 X:51604806-51604828 CTTCTCTTAGTGAAGAAAATTGG + Intergenic
1190784997 X:53637853-53637875 CTTGTCTTCCTGATAAAAATAGG - Intronic
1192202259 X:69073876-69073898 CCTCTGTTCCTGAGGACACTGGG + Intergenic
1193707554 X:84841159-84841181 CTTCATTTCTTTAAGAAAATTGG - Intergenic
1193996491 X:88371693-88371715 GTTCTGTCACTGAAGCAAATTGG - Intergenic
1195485791 X:105404535-105404557 CTCCTGTCCCTGAACAGAATAGG - Intronic
1196910376 X:120478816-120478838 CTTCTTTGTCTGAAGAATATTGG + Intergenic
1197043370 X:121967651-121967673 CTTCTGTTGCTGACTAAAATGGG + Intergenic
1197164584 X:123362575-123362597 CTTCTGTTGCTGTTGAAAAAAGG - Intronic
1197587671 X:128369362-128369384 GTTCTGTTACTAAAGAAGATGGG + Intergenic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1199448626 X:147955242-147955264 CTTCTGTTTCTGGAGAAATTTGG - Intergenic
1199685494 X:150261467-150261489 CTTCTTCTCCTACAGAAAATAGG - Intergenic
1199838412 X:151617702-151617724 TTTCTGTTCCTGATGCAAACTGG + Intronic
1201574914 Y:15452745-15452767 CTTCTGTTTTTAAAGAAACTAGG + Intergenic
1202297789 Y:23378219-23378241 CTTCTATTCCTACAGAAAACAGG - Intergenic
1202573020 Y:26292378-26292400 CTTCTATTCCTACAGAAAACAGG + Intergenic
1202589371 Y:26466334-26466356 CCTCCATTCCTGAAGAAGATGGG - Intergenic