ID: 1116626155

View in Genome Browser
Species Human (GRCh38)
Location 14:47266481-47266503
Sequence ATGATTGAGCATGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116626155 Original CRISPR ATGATTGAGCATGAGGAGGC AGG (reversed) Intronic
900946482 1:5834009-5834031 ATTCCTGAGCAAGAGGAGGCTGG + Intergenic
902780051 1:18699076-18699098 ATGAATGAACAAGGGGAGGCAGG - Intronic
903715067 1:25359257-25359279 ATGGTTGGCCATGAGGAGGCAGG - Intronic
904590666 1:31613677-31613699 AGGATGGAGCCTGTGGAGGCAGG - Intergenic
905720853 1:40200158-40200180 ATGATTTAGCAAGTGGAGTCTGG - Intronic
908763761 1:67536106-67536128 ATGATTGACCATGAGTTGGTAGG - Intergenic
912731456 1:112110216-112110238 ATGATTAAGCTTGGGGAGGAAGG - Intergenic
913014990 1:114723882-114723904 ATGATTGAGATTGTGGAGGAGGG - Exonic
918189698 1:182162379-182162401 ATGATGCAGCATGTGGAGGTAGG + Intergenic
919615782 1:199806776-199806798 ATTATTGAGCATGAGAAAGAAGG - Intergenic
920036228 1:203067552-203067574 AAGGAGGAGCATGAGGAGGCTGG + Intronic
921605913 1:217154389-217154411 ATGGTAGAGCATGAGGGGACAGG + Intergenic
921644630 1:217599097-217599119 ATGGTTGAATATGAGAAGGCTGG + Intronic
921780056 1:219152214-219152236 ATGAATGAGCAAGAGGAGAGCGG + Intergenic
921900142 1:220441339-220441361 TTGTTTGAGGATGAGGAGGGTGG + Intergenic
922008676 1:221558604-221558626 ATGAGTAAGCATGATGGGGCAGG - Intergenic
922722649 1:227906531-227906553 AGGATGGAGCAGGAGGAGGGAGG - Intergenic
923109479 1:230879656-230879678 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923109576 1:230879958-230879980 GTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109596 1:230880032-230880054 TTGATTGAGGAGGGGGAGGCTGG - Intergenic
923296149 1:232596878-232596900 GTCCTTGAGCAGGAGGAGGCCGG - Intergenic
923389268 1:233497913-233497935 ATGTTTAAGCATGTAGAGGCTGG + Intergenic
923441098 1:234021337-234021359 ATGAGGGAGCATGAGGATGCTGG - Intronic
923936881 1:238771237-238771259 ATAAAAGAGAATGAGGAGGCCGG - Intergenic
924402268 1:243697865-243697887 ATGATTGAGCATTAAGTGGTGGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1063740104 10:8807976-8807998 AAGACTGAGCAAGAGGAGGTAGG + Intergenic
1063905818 10:10779108-10779130 ATGATACAGTATAAGGAGGCGGG - Intergenic
1067295495 10:44973168-44973190 AGAAGTGAGCATGAGGAGGTGGG - Intronic
1067707683 10:48622956-48622978 AGCATTGAGTATGGGGAGGCAGG - Intronic
1070337453 10:75468114-75468136 ATGATGGAGCATCAGTAGTCTGG + Intronic
1070358593 10:75664516-75664538 ATGATGGAGGAAGAGGAGTCAGG + Intronic
1070569280 10:77628882-77628904 AGGATGGAGCAAGAGGAGGAGGG + Intronic
1070644137 10:78189708-78189730 ATCATGGAGCATTAGGAGGAGGG + Intergenic
1072015534 10:91342705-91342727 ATCATGGGGCATGAGGAAGCAGG + Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074748123 10:116555661-116555683 ATAAGTGGGCATGAGGAGACTGG + Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1077548088 11:3185206-3185228 ATGTTGGAGGAGGAGGAGGCTGG - Intergenic
1079878179 11:25887497-25887519 ATGATTGTGCATGATTAGGCAGG - Intergenic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1083119048 11:60492521-60492543 ATGATTGAGCATTAGAAAGCTGG + Intergenic
1084582348 11:70031952-70031974 ATGATGGACCGTGAGGAGGGGGG - Intergenic
1085125638 11:74000422-74000444 ATGATTGAGCACGTGGTGGGGGG + Exonic
1085633266 11:78137502-78137524 ATGATTGAGCTTGATGAGGAAGG - Intronic
1090007730 11:123017639-123017661 ATGGTGGAGAAGGAGGAGGCTGG + Intergenic
1090018008 11:123102851-123102873 AAAATTGGGCAGGAGGAGGCTGG - Intronic
1090270316 11:125381278-125381300 ACGCTGGAGCATGGGGAGGCTGG + Intronic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1093823239 12:23648015-23648037 ATGATTGAGCTTGATGAAGAAGG - Intronic
1094210331 12:27883783-27883805 ATCATTTAGCATGGGGAGGAGGG - Intergenic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1097257348 12:57689309-57689331 ATGATGGAGTTTGAGGGGGCTGG + Intergenic
1098506174 12:71253254-71253276 ATGATCAAGCCTGAGGAGGGGGG - Intronic
1100130437 12:91486642-91486664 ATTATTGAGCATGAAGAGAAGGG + Intergenic
1100274266 12:93057755-93057777 ATGAGTGAGCTTGAGGAGCATGG - Intergenic
1100990307 12:100244580-100244602 ATTATTCAGCAGGATGAGGCAGG - Intronic
1101569168 12:105937215-105937237 ATGTTTGTGCATGAGGTGGGAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102230389 12:111257695-111257717 AAGATGGAGAATGAGGAGGAAGG - Intronic
1102560679 12:113760126-113760148 ATGATACAGCATGAGGGGCCGGG + Intergenic
1104857763 12:131909899-131909921 ATGCTGGGGCAAGAGGAGGCTGG - Exonic
1104864891 12:131947457-131947479 ATAAATGAGCATTAGAAGGCTGG - Intergenic
1105600438 13:21881826-21881848 ATGACTGAGGGAGAGGAGGCAGG - Intergenic
1106919257 13:34545723-34545745 TTGATTGAAAATGAAGAGGCAGG - Intergenic
1110169747 13:72486332-72486354 ATGATTAAGAATGAGCAGGTGGG - Intergenic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1111104227 13:83624776-83624798 ATTTTTGAGCCTGAGGAGGGGGG + Intergenic
1111575792 13:90152975-90152997 ATGATTGAGCTTAATGAGGAAGG - Intergenic
1113179617 13:107610599-107610621 ATGATTGAGAATCCAGAGGCTGG - Intronic
1115967206 14:38904244-38904266 CAGATTGAGTATGAGGAGCCAGG + Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1117771249 14:59136395-59136417 ATTGTTGAGCATGAGGTGGCTGG + Intergenic
1118015044 14:61651897-61651919 GTGATTGAGAGGGAGGAGGCAGG + Intronic
1118981902 14:70723941-70723963 ATGACAGAGGATGAGGAGGGTGG + Intronic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1123894313 15:24813283-24813305 TGGATTGAGGATGAGGAGGCTGG + Intergenic
1126821137 15:52505217-52505239 ATCATTGAGCACCTGGAGGCCGG - Intronic
1129257784 15:74343868-74343890 AAGGTTGAGCATGGGGACGCTGG + Exonic
1129664946 15:77574324-77574346 CTGACAGGGCATGAGGAGGCAGG + Intergenic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1129847333 15:78773995-78774017 ATGGTAGAGCATGGGGAGGGTGG + Intronic
1130254548 15:82319856-82319878 ATGGTAGAGCATGGGGAGGGTGG - Intergenic
1130542315 15:84829547-84829569 ATGATTATTCATGAGGAGGTAGG + Intronic
1130560254 15:84952474-84952496 ATGAGTGAGCCTGACCAGGCTGG + Intergenic
1130600417 15:85270114-85270136 ATGGTAGAGCATGGGGAGGGTGG + Intergenic
1130696644 15:86138196-86138218 ATGGCAGAGCATGGGGAGGCTGG - Intergenic
1132245832 15:100295495-100295517 CTGAGGGAGCATGGGGAGGCTGG - Intronic
1133238778 16:4402765-4402787 ATGGTTGAGCCTGATGAGCCGGG - Intronic
1134078122 16:11306593-11306615 GTGATGGTGCATTAGGAGGCGGG + Intronic
1136229540 16:28878440-28878462 ATGAGGGAGCAGGGGGAGGCCGG - Exonic
1137071873 16:35910717-35910739 AGGACTGAGCCTGAGGAGGGAGG + Intergenic
1137301831 16:47156748-47156770 ATGATCAATCATGAGAAGGCTGG + Intronic
1137305047 16:47190909-47190931 ATGAAAGACCATGAAGAGGCAGG - Intronic
1137895314 16:52205645-52205667 ATGTATGAGCATGAGGAGAGGGG - Intergenic
1137950154 16:52775965-52775987 ATGAATGAGGATGCCGAGGCTGG - Intergenic
1139332332 16:66203107-66203129 ATGATTGAGGATGAAGAGTAAGG - Intergenic
1141100972 16:81197337-81197359 ATGTTTAAGCATGTGGAGGTGGG - Intergenic
1141666042 16:85465681-85465703 AACATAGACCATGAGGAGGCAGG - Intergenic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1143490277 17:7281970-7281992 AGGATTCATCATGAGGGGGCGGG + Intronic
1145726879 17:27137398-27137420 ATGATTGAGCTTAATGAGGAAGG + Intergenic
1147862038 17:43529499-43529521 CTCATTGAGCCTGAGGAGGTGGG - Exonic
1150266321 17:63834477-63834499 ATGATCCAGCATGAGCAGGAGGG + Exonic
1152002478 17:77655319-77655341 AAGGTTGAGGCTGAGGAGGCTGG + Intergenic
1154031223 18:10755980-10756002 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154031258 18:10756118-10756140 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154305356 18:13226865-13226887 AAGAGGGAGGATGAGGAGGCTGG - Intronic
1160839981 19:1142074-1142096 AGGGTTGATCATGAGGAGGGAGG - Intronic
1161871620 19:6874937-6874959 ATCATTGAGCTTGGGGAGGGGGG + Intergenic
1162892682 19:13745364-13745386 ATAATAAAGCATGGGGAGGCCGG + Intronic
1164558095 19:29268955-29268977 AGGCTCGAGCATGAGGAAGCTGG - Intergenic
1165552057 19:36595171-36595193 GTGATTGAGAAATAGGAGGCCGG - Intronic
1166959407 19:46488726-46488748 AGGCTGGAGCAGGAGGAGGCTGG - Intronic
1167058850 19:47130931-47130953 ATGGTGGAGAAGGAGGAGGCTGG + Exonic
1168465011 19:56595084-56595106 AGGATTGAGGGGGAGGAGGCAGG - Intergenic
1168537363 19:57182182-57182204 ATGATTATTCATGAGGAGGTGGG - Intergenic
927086714 2:19679487-19679509 AGCATGGAGCATGAAGAGGCTGG - Intergenic
927925961 2:27013910-27013932 ATGATTGAGCATGGGGCTGTTGG - Intronic
928295926 2:30083973-30083995 ATGACCGAGCATGAGGGTGCAGG + Intergenic
929024417 2:37585838-37585860 ATGATTGAGCATGGGGAGAGGGG - Intergenic
930271358 2:49261465-49261487 ATGGTTAAGCATGTGGATGCTGG + Intergenic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
932857444 2:75251254-75251276 ATGATTGCACATGTGGAGACTGG + Intergenic
933037514 2:77418957-77418979 ATAAGTGAACATCAGGAGGCAGG - Intronic
936859076 2:116994470-116994492 TTAATTGAGCTTGAGGAGGCGGG - Intergenic
936959908 2:118062032-118062054 ATGATATAGCAAGAGGTGGCTGG + Intergenic
937084710 2:119163374-119163396 GTGAGTGAGCATGAGAAGGTGGG + Intergenic
938235097 2:129699481-129699503 AGGATGGAGGATGAGGAAGCAGG + Intergenic
938560938 2:132471293-132471315 ATCAATGAGTATGAGGAGACAGG - Intronic
939373092 2:141328440-141328462 AGGATTGAGCATGAGGAGAGAGG - Intronic
940185331 2:150978197-150978219 ATGATTGCGCCTGAGGAAACTGG - Intergenic
941329270 2:164158903-164158925 ATTATTCAGCATCAGGTGGCAGG - Intergenic
943165705 2:184322659-184322681 ATGATTGAGCTTGAGGACTTTGG + Intergenic
943683417 2:190791780-190791802 ATGATTCAGCCTGAGGGGGCTGG - Intergenic
944917937 2:204380274-204380296 ATGATAGAGGAAGAGGAAGCTGG + Intergenic
945178312 2:207065846-207065868 ATGATGGTGGATGAGGAGTCAGG - Intergenic
945243468 2:207697677-207697699 AGGCTTGAGGATGAGGAGCCTGG + Intergenic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946412406 2:219521931-219521953 ATGAGTGAGGATGGGAAGGCAGG + Intronic
946831891 2:223735853-223735875 AAGTTTGAACATGAGGAGGAGGG - Intergenic
1168840569 20:907405-907427 ATACCTGAGCCTGAGGAGGCAGG - Intronic
1169058736 20:2644838-2644860 ATTATTGAGCATGAGGAACTTGG - Intergenic
1170058150 20:12229827-12229849 GAGATTGAGGATGAGGAGGGAGG - Intergenic
1170164204 20:13345021-13345043 GTAAATGTGCATGAGGAGGCTGG - Intergenic
1170874000 20:20234003-20234025 ATGATGAAGACTGAGGAGGCGGG - Intronic
1172776592 20:37411050-37411072 ATGCTGGAGCAAGGGGAGGCGGG - Intergenic
1175403559 20:58713654-58713676 ATAACTGGGCACGAGGAGGCAGG + Intronic
1182076610 22:27499441-27499463 ATGGCAGAGCAAGAGGAGGCCGG - Intergenic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1184639824 22:45864649-45864671 ATGAATGGGGATGAGGAAGCAGG - Intergenic
950729248 3:14942522-14942544 ATGCTTGAGCCTGGGGAGGTAGG - Intergenic
950902541 3:16511131-16511153 ATGACTGAGAATGAGGATGAAGG + Intronic
951285202 3:20802834-20802856 ATGATTGATGATGAGAATGCAGG - Intergenic
951755299 3:26084801-26084823 TTGGTAGAGCAGGAGGAGGCAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960455151 3:117861980-117862002 ATGATTGAGCATGAATAAGTGGG - Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
965168929 3:165235171-165235193 CTGATTGCCCATGGGGAGGCAGG - Intergenic
965734083 3:171802740-171802762 ATGAATGAGCATGAGAAATCAGG + Intronic
966596170 3:181726286-181726308 AAGATTGAGGGCGAGGAGGCTGG - Intergenic
968427361 4:532860-532882 AAGATGGAGCGTGGGGAGGCGGG + Intronic
968566548 4:1316535-1316557 ATGGCTGGGCATGGGGAGGCTGG - Intronic
968762310 4:2449130-2449152 ATGAAGGAGCAGGAGGGGGCCGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969045574 4:4334196-4334218 ATGATTGAGTCTGGGGATGCTGG - Intergenic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
971015458 4:22484673-22484695 GTGATTCAGCATGAGAAGGCTGG + Intronic
975717070 4:77215436-77215458 CTGATAGATCATGAGCAGGCTGG - Intronic
980599779 4:135007281-135007303 TTGATTGACCCTGAGGAGACTGG + Intergenic
989387387 5:40867165-40867187 AGGATAGAGCCTGAGAAGGCAGG - Intergenic
989422667 5:41257777-41257799 CTAATTCAGCATGAGGGGGCTGG - Intronic
990978515 5:61580205-61580227 ATGATGGAGCATGATGAGCAAGG + Intergenic
991667440 5:69013291-69013313 ATGATTGAGGATGTTAAGGCTGG - Intergenic
992006459 5:72483258-72483280 ATGATAGAGGATGAAGAAGCTGG - Intronic
995324007 5:110871658-110871680 ATGACAGAGCTTTAGGAGGCTGG - Intergenic
995581364 5:113606404-113606426 CTGATTGAGCAGTTGGAGGCGGG - Intergenic
998931902 5:147190577-147190599 ATGAGTGACCATGTGGAGGGAGG - Intergenic
999150044 5:149420823-149420845 TGGATTGAGCATCAGGAGCCTGG + Intergenic
999788239 5:154911718-154911740 CTGACTGACCTTGAGGAGGCCGG + Exonic
1001964190 5:175898874-175898896 ATGATTCAGCCTTAGGAGGGAGG - Intergenic
1006547747 6:34793140-34793162 GTAATTTGGCATGAGGAGGCTGG + Intronic
1009774797 6:68193046-68193068 AGAATTGAACATCAGGAGGCAGG - Intergenic
1012815269 6:104016223-104016245 TTGATGGAACATGAGGTGGCAGG - Intergenic
1014258113 6:119184562-119184584 AGGATGAAGCCTGAGGAGGCAGG + Intronic
1015515418 6:134078411-134078433 ATAATTGAACCTGAGGAGGGGGG - Intergenic
1016555445 6:145331193-145331215 ATGTTTTAGCATGCAGAGGCAGG - Intergenic
1018620497 6:165725633-165725655 AAGAATGAGCATCAGGAGACAGG - Intronic
1018996516 6:168714491-168714513 ATGATTGATGATGAGGATGATGG + Intergenic
1019388149 7:770328-770350 CTGATTGAGAAAGAGGAAGCGGG + Intronic
1020264180 7:6549394-6549416 AAGATTAAGAATGAGGAGCCTGG - Intronic
1022551286 7:31241900-31241922 ATGAGTAAACATGAGGGGGCAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022669262 7:32440573-32440595 ATTAATGAGCTCGAGGAGGCTGG - Intergenic
1022752960 7:33251451-33251473 ATGGCTGAGCATGAGGAGAGGGG + Intronic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1022942850 7:35256356-35256378 ATGAGTGATCGTTAGGAGGCAGG + Intergenic
1023354000 7:39349367-39349389 ATGCTGTGGCATGAGGAGGCAGG - Intronic
1027769851 7:82392668-82392690 ATGATTGAACATGTTGATGCAGG - Intronic
1027859689 7:83561468-83561490 ATGATTAGGGATTAGGAGGCAGG - Intronic
1028979304 7:96949638-96949660 ATGAGGGAGTAGGAGGAGGCTGG - Intergenic
1029187158 7:98747455-98747477 TTGATTGAGAATGAGTAGTCTGG - Intergenic
1030064850 7:105651784-105651806 ATGTTTGTGCATGAGGAGGCTGG - Intronic
1031735868 7:125360749-125360771 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1033235941 7:139637825-139637847 AGGTTTGGGCATGAGGGGGCAGG + Intronic
1033441346 7:141382238-141382260 ATGATTCATAATGAGGAGTCTGG - Intronic
1034125138 7:148664610-148664632 AAGACTGAGCAAGAGGAGGTAGG - Intergenic
1034831329 7:154310599-154310621 AGTATTGAGAATGAGGGGGCTGG - Intronic
1035905386 8:3503922-3503944 ATGAGTGAGAATATGGAGGCGGG + Intronic
1037459179 8:19092269-19092291 ATGAATGAGAATTGGGAGGCAGG - Intergenic
1038020759 8:23550412-23550434 AGGAATGAGCAAGAGGAGGCTGG + Intronic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1040377339 8:46839150-46839172 ATTTTTTAGCATGAGGGGGCAGG + Intergenic
1041770037 8:61463447-61463469 ATGATTAAGCTTGGGGAGGAAGG - Intronic
1046526589 8:115388816-115388838 ATGATGGCCCATGAGGAGCCAGG - Intergenic
1048045179 8:130766361-130766383 ATGATTGAGCATGGGGCGTGTGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1051752814 9:20361450-20361472 AGGATTGAACATGTGGAGCCCGG + Intronic
1052200557 9:25773767-25773789 ATGATTAATCATAAGGAGGTGGG + Intergenic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1057862486 9:98652550-98652572 TTTCTAGAGCATGAGGAGGCTGG - Intronic
1057931352 9:99196228-99196250 ATGATGGAGGAGGAGGATGCTGG + Intergenic
1058066424 9:100553661-100553683 ATGATTGAGCATGAGTTGTATGG + Intronic
1059227662 9:112687615-112687637 ATGAATGTGCATGAGCATGCTGG + Exonic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1062021852 9:134323321-134323343 CTGGCTGAGCATGAGGAAGCTGG - Intronic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1188040966 X:25369535-25369557 ATGCTTGAGCATGGGGAGATGGG + Intergenic
1188855604 X:35191538-35191560 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1189842398 X:45094373-45094395 ATGGGTGAAAATGAGGAGGCAGG + Intronic
1190970171 X:55341112-55341134 AAGACTGTGTATGAGGAGGCTGG + Intergenic
1191802715 X:65099027-65099049 ATGATTGAGCATGGTGGGGGAGG + Intergenic
1192608295 X:72542666-72542688 ATGAGTGATCATGCGGAGGAAGG + Intronic
1195818975 X:108921914-108921936 ATGATTGAGCTTAGGGAGGAAGG + Intergenic
1196286049 X:113881826-113881848 ATTATTGAACACGAGGAGGGAGG - Intergenic
1197290145 X:124645932-124645954 ATGATAGATCTTGAGGAGGTGGG - Intronic
1198728287 X:139700326-139700348 ATGATTGAGAATGAAGATTCTGG - Intronic