ID: 1116626592

View in Genome Browser
Species Human (GRCh38)
Location 14:47272591-47272613
Sequence CTGGAGTACTAGGGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116626592_1116626598 3 Left 1116626592 14:47272591-47272613 CCACTTTTTCCCTAGTACTCCAG 0: 1
1: 1
2: 2
3: 16
4: 240
Right 1116626598 14:47272617-47272639 GGCTTTTAATGAAGAAGAAAAGG 0: 1
1: 0
2: 2
3: 53
4: 534
1116626592_1116626599 4 Left 1116626592 14:47272591-47272613 CCACTTTTTCCCTAGTACTCCAG 0: 1
1: 1
2: 2
3: 16
4: 240
Right 1116626599 14:47272618-47272640 GCTTTTAATGAAGAAGAAAAGGG 0: 1
1: 0
2: 5
3: 79
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116626592 Original CRISPR CTGGAGTACTAGGGAAAAAG TGG (reversed) Intronic
901057826 1:6456998-6457020 CTGGGTTACTAGGGGAAAGGAGG + Intronic
903046277 1:20566486-20566508 CTGGGGTACAAGGAAAGAAGAGG - Intergenic
906716466 1:47973341-47973363 ATGGACTACTGGGGAGAAAGGGG + Intronic
907110421 1:51921873-51921895 GTGGAATAATAGGGAGAAAGAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908835353 1:68224190-68224212 ATGGAGTACTAAGGAGAAAGGGG + Intronic
909231531 1:73097177-73097199 CTAGAGCACTGGGGAGAAAGGGG + Intergenic
912676665 1:111687976-111687998 CTGGAGTACAAGGAATACAGCGG - Intronic
913960971 1:143337918-143337940 CTGGAGTGCCAGGGCAAGAGGGG + Intergenic
913986032 1:143566909-143566931 CGGGAGTGCTAGAGAAAGAGAGG - Intergenic
914055324 1:144163490-144163512 CTGGAGTGCCAGGGCAAGAGGGG + Intergenic
914123821 1:144802871-144802893 CTGGAGTGCCAGGGCAAGAGGGG - Intergenic
915717820 1:157961193-157961215 ATGGAGTATTAGAGAAAAAGAGG + Intergenic
916063424 1:161117889-161117911 CTGGAATACTAGCGAGAAGGGGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919438190 1:197590749-197590771 CAGGAGTACTGGGGAACCAGTGG - Intronic
924063940 1:240205244-240205266 CTGGAATAAAAGGGAAAGAGAGG - Intronic
1063391519 10:5652776-5652798 CAGGAGAACTTGGGAAAGAGGGG - Intronic
1064451328 10:15444721-15444743 CTGGAAGTCTAGGGAGAAAGAGG + Intergenic
1065466434 10:26028805-26028827 CTAGAGTCCTAGGGGAAATGTGG + Intronic
1066411857 10:35178626-35178648 CAGAAATACTAGGGAAAGAGTGG - Intronic
1067029412 10:42870320-42870342 CTGGAGTGCCAGGGCAAGAGGGG + Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1069608131 10:69753098-69753120 CTGGGTAACTAGGGACAAAGGGG - Intergenic
1069967497 10:72133115-72133137 CTGGACTAATAGTGAAAGAGTGG - Exonic
1070000575 10:72373662-72373684 CAGGACTTCTAGGGAAAAGGGGG + Intronic
1070864042 10:79695140-79695162 CTGTAATTCTAGGGACAAAGTGG - Intergenic
1071630939 10:87217366-87217388 CTGTAATTCTAGGGACAAAGTGG - Intergenic
1071810584 10:89176737-89176759 CTGGAATATTAGGGAAAATGAGG - Intergenic
1071836512 10:89423678-89423700 CTGGAGTCCTGGGAGAAAAGGGG - Intergenic
1072836125 10:98714582-98714604 CTTGATTAATAGGGAAAATGTGG - Intronic
1073585351 10:104704664-104704686 CTAGAGTACTAGGGAAAAATTGG - Intronic
1073670111 10:105578818-105578840 CTAGAGTACTGGGGAAATAATGG + Intergenic
1073818543 10:107234234-107234256 GTGGAGTAATAGGGAAAAGTAGG - Intergenic
1077745572 11:4900749-4900771 CTGGAATACTAGTGACAAAGAGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1080932390 11:36825533-36825555 CTGAAGACCTAGGGAGAAAGGGG + Intergenic
1082119483 11:48363065-48363087 TTGGAATGCTAGGAAAAAAGAGG - Intergenic
1082254819 11:50022097-50022119 TTGGAATGCTAGGGAAAGAGAGG + Intergenic
1082878506 11:58014136-58014158 CTGGAGCAGAAGGGAAAGAGAGG + Intergenic
1082878997 11:58019771-58019793 CTGGAGAACAAAGGAAATAGAGG - Intergenic
1083540893 11:63510886-63510908 CTGGAATAATAGGGAAGAACGGG - Intronic
1085469372 11:76747472-76747494 CTGTAGGAATAGGGAAAATGAGG - Intergenic
1085818211 11:79763943-79763965 CTGGATTGCAAGGGAAAAAATGG + Intergenic
1086400727 11:86459231-86459253 CTGGAATAATAGGGAATATGTGG + Intronic
1087450574 11:98316736-98316758 CTGTAGAACTACGGAAAAAGGGG - Intergenic
1090415473 11:126537330-126537352 CTGGATTACAAGGGATAAAGTGG + Intronic
1090615500 11:128510732-128510754 CTGGATTACTAGGGAAGGGGAGG - Intronic
1091959951 12:4685298-4685320 CTGGATAACAAGGGATAAAGTGG + Exonic
1092031981 12:5294019-5294041 GAGGAGTACTAGGGGAAAGGAGG + Intergenic
1092217988 12:6695652-6695674 CTGGGGTACCAGAGGAAAAGAGG + Intronic
1095341508 12:41094697-41094719 CAGGAGAACTAGGAAAAAATGGG - Intergenic
1096146934 12:49284915-49284937 CAGCAGGACTAGGGAGAAAGAGG - Intergenic
1096811768 12:54175104-54175126 CTGGGGCACCAGGGAAGAAGAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1098981621 12:76962672-76962694 CTGGAGTAAGGGGGAGAAAGGGG + Intergenic
1099987496 12:89684556-89684578 CTGAAGGATTAGGGAAATAGTGG + Intronic
1100369843 12:93958028-93958050 CTGGAGGGCTAGAGAATAAGTGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101968090 12:109294468-109294490 CTGGAGTAGTGGGGAAGCAGGGG - Intronic
1102426601 12:112848805-112848827 CTGGGGGACTGGGGAAAATGTGG + Intronic
1103394697 12:120598671-120598693 TTGGAGTACTGGGGATACAGCGG - Intergenic
1103564467 12:121808507-121808529 CAGGAGCACTTGGGAAAATGGGG - Intronic
1103790516 12:123467020-123467042 CTTGAGTACGTGGCAAAAAGAGG + Intronic
1106958335 13:34968954-34968976 CTGGAGTAAGAGGCACAAAGAGG - Intronic
1107097079 13:36548502-36548524 ATGGAGTAATGCGGAAAAAGTGG - Intergenic
1107625052 13:42273232-42273254 ATGGAGTACTAAGAAAAAATGGG + Intronic
1108130378 13:47293037-47293059 CTGGAGTACTGTGGAAAACAAGG - Intergenic
1109392553 13:61711044-61711066 CTGGACTACCAGGGAGAAATTGG + Intergenic
1110446881 13:75594892-75594914 CTGGAATAGGAGGGAAAAATAGG - Intronic
1112629768 13:101147908-101147930 ATGGAGTTCAAGAGAAAAAGAGG - Intronic
1112644581 13:101315127-101315149 CTGTAATGCTAGGGAAAAATTGG + Intronic
1112719797 13:102230481-102230503 TGGGAGTACAAAGGAAAAAGTGG + Intronic
1115909438 14:38239404-38239426 CTGCATTACTATGGAAACAGAGG + Intergenic
1116155665 14:41201713-41201735 ATGGATTAATAGGGAAAAATTGG + Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1116977563 14:51132699-51132721 CTGGAGTACCAGAGGAAATGGGG + Intergenic
1119042380 14:71286713-71286735 CTGGAATACAAGGAAAAAGGGGG + Intergenic
1120511541 14:85421661-85421683 CTGTAGTACTGGGGAAAAAAGGG + Intergenic
1120621187 14:86766707-86766729 CAGGAGTACAAGAGAAAAATTGG + Intergenic
1122634051 14:103122109-103122131 CTGGAGTCCTAGGAGAGAAGGGG + Intergenic
1123494243 15:20809153-20809175 CTGGGGGAGTAGGGGAAAAGGGG + Intergenic
1123550740 15:21378236-21378258 CTGGGGGAGTAGGGGAAAAGGGG + Intergenic
1125371820 15:38985750-38985772 CTGCAATACTAGGAAAATAGAGG + Intergenic
1127184997 15:56469579-56469601 CTAAGGTCCTAGGGAAAAAGAGG + Intergenic
1130441686 15:83961026-83961048 CTTGATGTCTAGGGAAAAAGTGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1132310313 15:100852815-100852837 CTGGAGGACCAGGGTAAAGGTGG + Intergenic
1202959081 15_KI270727v1_random:105489-105511 CTGGGGGAGTAGGGGAAAAGGGG + Intergenic
1133138053 16:3725861-3725883 TTGGGGGACTAGGGATAAAGTGG + Exonic
1133712160 16:8411737-8411759 CTGGGGTACCAGGTAAAAATGGG - Intergenic
1139345577 16:66300863-66300885 CTGGATTAAGAGGAAAAAAGTGG + Intergenic
1142003825 16:87679772-87679794 CTGGAGAACTGGGGTAAGAGAGG - Intronic
1144376400 17:14646324-14646346 ATAGAGTACCAGGGAAGAAGAGG - Intergenic
1144834225 17:18148524-18148546 CTGGAGTACGGGGGAAGAGGTGG + Exonic
1144875274 17:18394223-18394245 CTGTAGTTCTAGGGAAATGGGGG - Intergenic
1145156950 17:20550198-20550220 CTGTAGTTCTAGGGAAATGGGGG + Intergenic
1145832308 17:27926523-27926545 CTGAAGTATTTGGGAATAAGGGG + Intergenic
1146673756 17:34759081-34759103 TGGGAGGACTAGGGAAATAGTGG + Intergenic
1148804161 17:50255943-50255965 CTGGAGTCTGAGGGACAAAGAGG - Intergenic
1149646508 17:58245293-58245315 CTGAAGGAGGAGGGAAAAAGGGG + Intronic
1154451769 18:14483608-14483630 CTGGGGGAGTAGGGGAAAAGGGG + Intergenic
1155142862 18:23058730-23058752 GTGGAGGGGTAGGGAAAAAGGGG - Intergenic
1155362830 18:25018923-25018945 ATGGAGTATGAAGGAAAAAGAGG - Intergenic
1157397575 18:47355655-47355677 CTTGAGCACTAGGAAAACAGGGG + Intergenic
1157925809 18:51765009-51765031 CTGGAGTTCCAGGGAAACACTGG + Intergenic
1158606243 18:58898802-58898824 CTGGGGTACCAGAGAAAAAGTGG - Intronic
1158876046 18:61735538-61735560 CTCGAGTAGAAGGGAAAAGGAGG - Intergenic
1161748545 19:6077005-6077027 CTGGATTTCTAGGGAAGAAAAGG - Intronic
1161897610 19:7094285-7094307 GTGGGGAACCAGGGAAAAAGCGG - Intergenic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1164783057 19:30909096-30909118 CTGGAGGCCTAGAGAACAAGAGG + Intergenic
1166980292 19:46627935-46627957 CTGAAGCAGCAGGGAAAAAGAGG + Intergenic
1167430135 19:49449412-49449434 CTTGGGTTCTAGGGAAGAAGGGG + Intronic
1168245309 19:55110139-55110161 CTGGGGTCCAAGGGAAAAGGAGG + Intronic
1168335962 19:55597902-55597924 CTGGAGTAGTGGGGAGACAGAGG + Intronic
1202694807 1_KI270712v1_random:116167-116189 CTGGAGTGCCAGGGCAAGAGGGG + Intergenic
1202710547 1_KI270714v1_random:17299-17321 CTGGGTTACTAGGGGAAAGGAGG - Intergenic
926075001 2:9935418-9935440 CTGGAGCACTGTGGATAAAGGGG + Intergenic
927910567 2:26895715-26895737 CTGGAGTAGTTGGGGTAAAGGGG - Intronic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
930016522 2:46974606-46974628 ATGGGGAACTAGGGAAAAGGAGG + Intronic
930178859 2:48330847-48330869 CTGGAGTAGTAGGGTCAAAATGG + Intronic
930283358 2:49397649-49397671 ATGGAGTCTTAGAGAAAAAGTGG + Intergenic
931223331 2:60307956-60307978 CTGGAGAACCAAGGAAAGAGAGG + Intergenic
934275979 2:91573216-91573238 CTGGAGTGCCAGGGCAAGAGGGG + Intergenic
935724017 2:106007517-106007539 CTAGAGGACTAGGGGAAAAATGG + Intergenic
935877762 2:107529894-107529916 CTGGAGCACTAGGGAGTTAGGGG + Intergenic
938479923 2:131652519-131652541 CTGGGGGAGTAGGGTAAAAGAGG - Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
940523926 2:154787444-154787466 GTGGAGGAGGAGGGAAAAAGAGG - Intronic
940764774 2:157778343-157778365 CTGGAGTTGGAGGGAAAAGGGGG + Intronic
942377727 2:175354508-175354530 GTGGAGTATAAGGGAGAAAGAGG - Intergenic
945806129 2:214491887-214491909 CTGGAGTACAAGAGAAAAAGGGG - Intronic
948100397 2:235368289-235368311 CAAAAGTACTAGGGAAAAGGAGG + Intergenic
1169205744 20:3739631-3739653 CTGGAGGGGCAGGGAAAAAGTGG - Intronic
1169326240 20:4679058-4679080 CTGGATTTCTAGGGAAACAAAGG - Intergenic
1170723691 20:18906310-18906332 CATGAGTACTTGGGAAAGAGAGG + Intergenic
1170854973 20:20044041-20044063 ATGGAGTATGAGGAAAAAAGAGG - Intronic
1173174228 20:40752167-40752189 CAGGAATACTGGGGAAGAAGTGG - Intergenic
1173686996 20:44930793-44930815 CTAGAGTTCTAGGGAAATGGAGG + Intronic
1175478134 20:59291495-59291517 CTGGAGAACTAGGGCAGAAGAGG + Intergenic
1176444375 21:6806612-6806634 CTGGGGGAGTAGGGGAAAAGGGG - Intergenic
1176822540 21:13671650-13671672 CTGGGGGAGTAGGGGAAAAGGGG - Intergenic
1177067533 21:16459689-16459711 CTGGAGCAATAGGGAAATTGCGG + Intergenic
1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG + Intergenic
1182875852 22:33690547-33690569 CTAGAGACCTGGGGAAAAAGAGG + Intronic
1183135962 22:35887965-35887987 AAGGAGTAATAGTGAAAAAGTGG - Intronic
1183136864 22:35897439-35897461 CTGGACAACAAGGGATAAAGTGG - Intronic
1183493462 22:38128690-38128712 CTGGAGTAGAAGGAAAGAAGGGG - Intronic
1184824087 22:46935326-46935348 CTGGAGTACATGAGAAAAAATGG + Intronic
1185107175 22:48880037-48880059 CTGGAGTTCAAGGGCAAAACTGG - Intergenic
1185126408 22:49013384-49013406 CTTGAGTCCTGGGGAAACAGAGG - Intergenic
949830051 3:8204625-8204647 CTAGAGTAGCAGGGAAAAAAGGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952152246 3:30606292-30606314 CTGATCTACTAGGGAAAACGTGG + Intergenic
955260708 3:57387578-57387600 TTGGAGTCCTAAGGAAGAAGGGG - Intronic
955516547 3:59731675-59731697 CTGGAGTTCAGGGGACAAAGAGG + Intergenic
957602856 3:82360404-82360426 CTGGAGTACACAGGAAAATGTGG + Intergenic
959690103 3:109189377-109189399 CTGGAGAACTTGGGACAGAGAGG - Intergenic
960189894 3:114690867-114690889 CTGGAGTTCTAAGTAATAAGGGG + Intronic
960251414 3:115459685-115459707 CTGGAATACCAGTGGAAAAGAGG - Intergenic
960348203 3:116561037-116561059 AAGGATTGCTAGGGAAAAAGAGG - Intronic
960411198 3:117327177-117327199 CTGGAGTAGTAGGGCAGAGGAGG - Intergenic
961437066 3:126926577-126926599 CTGGAGTATTAGGGGAAAGATGG + Intronic
963506936 3:146198160-146198182 CTGAAGGGCTAGGGACAAAGAGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965717256 3:171618602-171618624 CTTGAGTATTAGGGCAAATGGGG + Intronic
967543560 3:190696960-190696982 CTGGGTCACTAGGGAAAAACCGG - Intergenic
970705078 4:18791549-18791571 TTGGAGTACTAGGTAAAATCAGG + Intergenic
972664744 4:41154149-41154171 CTGGAGAACTGGGGAGAAATTGG - Intronic
972669712 4:41203704-41203726 CTGGAGTACTGGGGAGAATTGGG - Intronic
972783444 4:42305965-42305987 CTACAGCACTAGGGGAAAAGAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974323298 4:60380531-60380553 CTGCACTAATAAGGAAAAAGTGG - Intergenic
974373167 4:61043377-61043399 GAGCAGTACTAGGGTAAAAGAGG - Intergenic
974415569 4:61602244-61602266 CTGGAAAAGTAGGGATAAAGAGG - Intronic
975132304 4:70841794-70841816 CTGGAGTATCAAAGAAAAAGGGG + Intergenic
975259970 4:72286934-72286956 ATGGAGGAGTAGAGAAAAAGAGG + Intronic
976177830 4:82373070-82373092 CTGTAGAAAAAGGGAAAAAGAGG + Intronic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
980307647 4:131083767-131083789 CTGAAGTATTAGGGAAAACTAGG + Intergenic
980744508 4:136998133-136998155 CTGGAGTACTAGAGGAGATGAGG - Intergenic
983394868 4:167181101-167181123 CTGGAGGATTAAGGAAAAAATGG - Intronic
986082956 5:4413075-4413097 GTGGACTTCCAGGGAAAAAGGGG + Intergenic
988010680 5:25478735-25478757 ATGGAGTTCAAGGGAAAAAAAGG - Intergenic
989393579 5:40928244-40928266 CTGGGGTAATAGGGAAATAAAGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991154994 5:63423600-63423622 CTGGAGGAATAGGGTAAAAAAGG - Intergenic
991245173 5:64502891-64502913 TTGGAGAACTAAGGGAAAAGGGG - Intergenic
991920557 5:71652654-71652676 CTGGAGAACTAAAGGAAAAGAGG - Exonic
992869045 5:80987647-80987669 CTGGAACACTGGGGAAAGAGGGG + Intronic
994297599 5:98109737-98109759 CTGGAGCACTAGGGAAAAAGTGG - Intergenic
995476442 5:112553027-112553049 CTGGAGTAGAAGGGAAGAGGAGG + Intergenic
998395319 5:141814449-141814471 GGGGAGTAATGGGGAAAAAGGGG - Intergenic
999848829 5:155515416-155515438 CTGGAGGACAGGGGACAAAGGGG + Intergenic
1000385388 5:160670332-160670354 CTAAAGTGCTAGGGAAAAGGAGG + Intronic
1000639599 5:163685948-163685970 TTGGAGGACTAGGGAGAAATTGG - Intergenic
1001422724 5:171599677-171599699 CTGGGGTGCCAGGAAAAAAGTGG - Intergenic
1004342496 6:14819658-14819680 CTGGAGTAGAAGGGAAAAGTGGG - Intergenic
1005844011 6:29763351-29763373 CTGGAGTGCTAGGGACCAGGAGG + Intergenic
1006166371 6:32068019-32068041 CTTGGGTACTGGGGAAAAGGAGG + Intronic
1007175310 6:39892462-39892484 GGGGAGTACTAGGGGACAAGAGG - Intronic
1007454235 6:41963847-41963869 GTGGAGATCTAGGGAAAGAGTGG - Intronic
1009673900 6:66791831-66791853 CTGTAGTATTAGGGTAACAGTGG - Intergenic
1009941038 6:70288243-70288265 TTGGAGTATGAGAGAAAAAGAGG - Intronic
1011516821 6:88164580-88164602 GAGGAGTACCAGGGAAAAAAAGG + Intronic
1012493433 6:99808680-99808702 CGAGAGTGCTTGGGAAAAAGAGG - Intergenic
1013541383 6:111113706-111113728 CTAAAGTAATAGAGAAAAAGAGG + Intronic
1015133690 6:129843324-129843346 GTGGAGTAATATGGAATAAGTGG - Intronic
1015167915 6:130219490-130219512 TTTGAGGACTCGGGAAAAAGTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020569405 7:9839504-9839526 CAGGAGGGCTAGGGAAAATGGGG + Intergenic
1022677848 7:32516508-32516530 CTGGATTACTAGGGGCTAAGTGG + Intronic
1024038419 7:45529414-45529436 CTGGAGCAATAGGGTAAAAATGG - Intergenic
1024521980 7:50313584-50313606 CAAGAGTGCTAGGGAGAAAGAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026348936 7:69498844-69498866 CTGGAGAACTAGGAAAATTGTGG + Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1027491304 7:78830791-78830813 CTGGATTCCTAAGCAAAAAGGGG + Intronic
1028156681 7:87437672-87437694 CTGAAGTAATAGGGGAAGAGGGG - Intronic
1029126341 7:98297389-98297411 CTGCAGCCCAAGGGAAAAAGTGG - Intronic
1031000173 7:116405790-116405812 GTTGAGGACTAGGGAGAAAGTGG + Intronic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1037670463 8:21011248-21011270 CTGGAGGTCCAGGGAAATAGTGG + Intergenic
1039166911 8:34692021-34692043 CTAGAGTACTAGAGTAAAGGGGG + Intergenic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1041315707 8:56560094-56560116 CTGAAGTAGTAGAGCAAAAGAGG + Intergenic
1042183994 8:66119081-66119103 CTGGAGCACTAGGGCACCAGTGG - Intergenic
1043669391 8:82863034-82863056 CTGGAGTCTCAGGGAAAATGTGG - Intergenic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1043989947 8:86740392-86740414 CTGGAGTAGAAGGGAAAGAAAGG + Intronic
1045418747 8:101993226-101993248 ATGTAGCACCAGGGAAAAAGTGG - Intronic
1047419992 8:124699751-124699773 GTGGAGTACTTGGAAAAAAGTGG - Intronic
1047886032 8:129251072-129251094 CTGGAATTCAAGGGAAAAGGAGG + Intergenic
1048247413 8:132822408-132822430 CTGGATCTCTAGGGAAAAGGTGG - Intronic
1048358836 8:133677132-133677154 TTGGAGTCCCAGAGAAAAAGGGG + Intergenic
1048643048 8:136385979-136386001 CTGGACTAATAGGGAAAAATGGG + Intergenic
1049465175 8:142747974-142747996 CAGGAGTAGAAGAGAAAAAGAGG + Intergenic
1052090196 9:24318235-24318257 CTGGAGTATAAAGGAAAAAGAGG + Intergenic
1052360843 9:27555269-27555291 CTGGAGAACTAGGAAAAAATGGG + Intronic
1052553041 9:29976464-29976486 AGGGAATACTAGGGAAAAAGAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054967939 9:71051058-71051080 GAGGAGTTCTAGGGGAAAAGAGG + Intronic
1055025147 9:71711669-71711691 CTGGGGGACTAGAGAATAAGAGG - Intronic
1055262539 9:74454841-74454863 TGGGAGTACAAAGGAAAAAGTGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1061710243 9:132482450-132482472 CTGGAGAAAAAGGGGAAAAGAGG + Intronic
1203524823 Un_GL000213v1:77915-77937 CTGGGGGAGTAGGGGAAAAGGGG + Intergenic
1186273043 X:7910030-7910052 CTGGCGTAATAGGGACATAGAGG + Intronic
1192340070 X:70257073-70257095 CTGGATATCTAGGGAGAAAGTGG + Intergenic
1192614105 X:72600097-72600119 CTTGAGTGATAGGGAAAAAATGG + Intronic
1194987864 X:100510736-100510758 CTGGAGTTGGAGGCAAAAAGAGG - Intergenic
1197275094 X:124468544-124468566 CTGGAGAAGGAAGGAAAAAGAGG - Intronic
1198671069 X:139081514-139081536 TTGGAGTACAAGGGAAAGACTGG - Intronic