ID: 1116630602

View in Genome Browser
Species Human (GRCh38)
Location 14:47326580-47326602
Sequence TTGAGAAGGAATAAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 11, 3: 63, 4: 540}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116630602 Original CRISPR TTGAGAAGGAATAAAACTGA AGG (reversed) Intronic
901255674 1:7824433-7824455 TTGAAAAAGAATAAAGCTGAAGG - Intronic
904078698 1:27858560-27858582 TCGAGAAGGAAAAAAACTCAGGG - Intergenic
905489781 1:38334327-38334349 TTTAGAAGGGACAAAACAGAAGG - Intergenic
906539297 1:46572778-46572800 ATCAAAAGGAATAAAACTGAAGG + Intronic
909062640 1:70896948-70896970 TTGAGTAGGAGTAAAACTCTAGG + Intronic
909477227 1:76094485-76094507 TTTACAAAGAAGAAAACTGAGGG + Intronic
909549969 1:76887044-76887066 CTGAGAAGGAAGAAAAAAGAGGG - Intronic
909767549 1:79375794-79375816 TTGAGAATTAAGAAAACAGACGG + Intergenic
909921420 1:81385503-81385525 ATGGGAAAGAATAAACCTGAGGG + Intronic
910140590 1:84022843-84022865 TTTGGGAGGAATTAAACTGAGGG + Intergenic
910325719 1:86004421-86004443 TTGGGCAGGATTAAAACTAATGG - Intronic
910433261 1:87179511-87179533 TCAAGAAGAATTAAAACTGATGG + Intergenic
910810217 1:91228046-91228068 TTGAGAAGGAATTCAGCTCATGG - Intergenic
911228154 1:95330902-95330924 TTGAGAAGGAAAAAAAGAGAGGG - Intergenic
911841953 1:102694065-102694087 TTGAGAAAGAAAAAAATTGGAGG + Intergenic
912359152 1:109080496-109080518 TGGAGATGTACTAAAACTGATGG + Intergenic
913305236 1:117423321-117423343 TTGAAAAGGAATAAAGTTGGAGG - Intronic
913351319 1:117863351-117863373 CTGACATGGAATAATACTGATGG + Intergenic
916104365 1:161420110-161420132 GTGGGAAGGAAGAAAAATGAAGG + Intergenic
916770329 1:167901631-167901653 TTGAGAAGGAATAAATCCTACGG - Intronic
918609260 1:186467952-186467974 TTTAGAAAGAACAAAACTGTAGG + Intergenic
918692063 1:187493555-187493577 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
918744203 1:188179091-188179113 TTTAGAAAAAATAAAAGTGAAGG - Intergenic
918777767 1:188657405-188657427 TAGAAAAGTTATAAAACTGAGGG - Intergenic
919485006 1:198134884-198134906 TTGGAAGGGAATAAAACTGATGG + Intergenic
920145097 1:203853499-203853521 TTGTGAAGGAATAAGCATGATGG + Exonic
921341092 1:214135590-214135612 ATGACAAGCAATAAAATTGATGG - Intergenic
921517338 1:216111858-216111880 TTGAGTAGGAATGAAGCTGAAGG - Intronic
921820203 1:219608506-219608528 TTGTGAAGGAATAAGCATGATGG - Intergenic
921833544 1:219754774-219754796 TTGAAAAGGAATAAAGTTGGAGG + Intronic
923244321 1:232117438-232117460 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
923920652 1:238560765-238560787 GTCAGAAGGAAAAAGACTGACGG + Intergenic
924399023 1:243657694-243657716 TTGAGAAAGCAAAAAGCTGAGGG + Intronic
924402569 1:243702272-243702294 TTGAGTGGGAAAGAAACTGAAGG - Intronic
924430530 1:243992716-243992738 TTGAAAAGGAATAAAATGTAAGG - Intergenic
1063200741 10:3783910-3783932 TTGAGGAGGAAAAAAACAGGAGG + Intronic
1063397659 10:5706279-5706301 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1064573083 10:16715742-16715764 TTGAGAAAGAACAAAACTGAAGG - Intronic
1064857690 10:19789307-19789329 TAGAGAAGAAAAAAAACTGGGGG - Intronic
1065714911 10:28556994-28557016 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1066633936 10:37482588-37482610 TTGAAAAGGAAAAAAAAAGAAGG - Intergenic
1066665289 10:37776883-37776905 TTGACAAACAAGAAAACTGACGG - Intronic
1068401476 10:56533384-56533406 TTTAGAAAGAATCAAAATGAGGG - Intergenic
1068473568 10:57496076-57496098 CAAAGATGGAATAAAACTGAAGG + Intergenic
1070503856 10:77096166-77096188 ATCAGAAGGCATGAAACTGAGGG - Intronic
1071232056 10:83599822-83599844 TTGAGCAGGAATAAGAACGAAGG + Intergenic
1071804379 10:89101009-89101031 TTAAAAAGGAATGAAACAGAAGG - Intergenic
1071920652 10:90346243-90346265 AAGAGAAGGAATAAAACTGGGGG + Intergenic
1072216151 10:93288927-93288949 CTGCAAAGGAATAAAACAGAAGG - Intergenic
1072751962 10:97987443-97987465 TTCAAAAGGACTAAAATTGAGGG + Intronic
1072848329 10:98857902-98857924 TTGAGTAGGAAAAAATGTGAGGG + Intronic
1072878395 10:99199716-99199738 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1073546929 10:104357358-104357380 TTTCTAAGGAATAAAAATGATGG + Intronic
1073547135 10:104360100-104360122 TTGACAAGGAATAAAATGGGTGG - Intronic
1073921806 10:108467226-108467248 ATGAGAAGGAAGAAAACTGAGGG - Intergenic
1074068599 10:110042703-110042725 CTAAGAAGTAAAAAAACTGATGG - Intronic
1074641639 10:115390621-115390643 ATGAGCAAGAATAAAACTGAAGG - Intronic
1075204078 10:120431707-120431729 ATGAGAACAAATAAAACTGATGG + Intergenic
1077874398 11:6291678-6291700 TTAAGAAGGAAATAAATTGAGGG - Intergenic
1077925254 11:6675763-6675785 TTGATAAAGAACAAAACTGGAGG + Intergenic
1078389568 11:10925207-10925229 ATGAGAAGGAAAAAAATTCAAGG + Intergenic
1079586882 11:22136661-22136683 TTGAGAAAGAACAAAGCTGGAGG + Intergenic
1079891860 11:26065891-26065913 TTGAGAAGGAAAACCTCTGAGGG - Intergenic
1080193477 11:29579472-29579494 TTGACAAGGAATAAGGCAGAAGG - Intergenic
1080285928 11:30611535-30611557 TTAAAAAAGAATACAACTGAAGG - Intergenic
1080497769 11:32837434-32837456 TTGATAAGGTACAAAACAGATGG + Intronic
1081478889 11:43465080-43465102 TTAAGAAGGGACAAAACTAAGGG + Intronic
1081713215 11:45231313-45231335 TTGAGAAGGACTTGGACTGATGG + Intronic
1081940858 11:46940328-46940350 TTGCAAAGGAACAAAACTGCAGG - Intronic
1082097393 11:48142285-48142307 TTGAGAAAGAATAAAGCTGGAGG - Intronic
1086045649 11:82528154-82528176 TTAAGAAGGATTAAAATGGAGGG + Intergenic
1086274115 11:85104745-85104767 TTGAAAAACAAAAAAACTGATGG + Intronic
1086721877 11:90130650-90130672 TTGTGAAGGAATAGCACTGGAGG + Intergenic
1087068784 11:94054285-94054307 TTGAGAGGGACCAAAATTGAGGG + Intronic
1087203386 11:95368304-95368326 TTGAGAGGAAATGAATCTGATGG - Intergenic
1088472501 11:110201416-110201438 AAGAGAGGGAATAGAACTGAAGG + Intronic
1088886458 11:114011339-114011361 TTGAGTAGAAATAAAATTGGTGG - Intergenic
1089479944 11:118796441-118796463 TTGCCGAGGAATAACACTGATGG + Intergenic
1089650914 11:119912254-119912276 TTGAGAGGGAACAAATCTGTTGG - Intergenic
1090099909 11:123783337-123783359 ATGAGAAGGAATAAAAAACATGG + Intergenic
1090343533 11:126047440-126047462 ATGAGTAGGATTAAAATTGAAGG - Intronic
1090544056 11:127743126-127743148 TTGAAAAAGAACAAAACTGGAGG - Intergenic
1090751861 11:129753360-129753382 TTGAGAAGATAAAATACTGATGG - Intergenic
1091071872 11:132572688-132572710 CTGAGAAAGAATAAAGCTGGAGG - Intronic
1091238036 11:134034563-134034585 CCGGGGAGGAATAAAACTGAGGG + Intergenic
1093013256 12:14130247-14130269 TTGAGGAAAATTAAAACTGAAGG - Intergenic
1093588421 12:20870758-20870780 TTGAGAAAGAACAAAGGTGATGG - Intronic
1094038230 12:26093629-26093651 TAGAGAAGGCATAAAAAGGAGGG - Intergenic
1094045929 12:26167007-26167029 TTCAAAACCAATAAAACTGAGGG + Intronic
1094258101 12:28458863-28458885 TTGAAAAGGCACAAAACTGGAGG - Intronic
1094419284 12:30253701-30253723 TAGAGAATTATTAAAACTGAAGG + Intergenic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1094766002 12:33595250-33595272 CTCAGTAGGAATAGAACTGATGG - Intergenic
1095184713 12:39188006-39188028 TTGGGAAGGAAAAAAAATTATGG - Intergenic
1095460740 12:42442281-42442303 TTCAGAGAGAATAAAGCTGAAGG + Intronic
1095668723 12:44834213-44834235 GAGAGAAGGAATGAAAATGAGGG - Intronic
1095771190 12:45959542-45959564 TTTAGATGGAAGAAGACTGAGGG + Intronic
1095990995 12:48034546-48034568 TTGAGGAGGGGTAAACCTGAGGG - Intergenic
1096441382 12:51646193-51646215 CTGAAAAGGAATGAAACTGGAGG + Intronic
1096720312 12:53516491-53516513 GAGAGAAGGAATAAAGCTTATGG + Exonic
1096804787 12:54134008-54134030 AAGAGAAGAAATAAAAATGAGGG - Intergenic
1096878869 12:54651138-54651160 ATGAGAAGGGTTGAAACTGAAGG - Intergenic
1096928149 12:55172653-55172675 TTCAAAAAGAACAAAACTGAAGG - Intergenic
1097391607 12:59021842-59021864 TTGAGAAGGCAGAGAACTCATGG - Intergenic
1097427896 12:59470066-59470088 TTGAAAAGCAATAAATGTGAGGG - Intergenic
1097651050 12:62297448-62297470 TTGAGAAGGCAGAGAACTCAAGG + Intronic
1098433767 12:70448069-70448091 TTTAGGAGAAATAAAACTTATGG - Intergenic
1098449576 12:70604471-70604493 TTTAGAAGGAATAGAGCTGAGGG - Intronic
1098526289 12:71490801-71490823 TTCAGAAGGCTTAAAGCTGAAGG + Intronic
1098810207 12:75078485-75078507 TGGAGAAGACATAATACTGAAGG - Intronic
1098812999 12:75120088-75120110 TACAGAATGAATAAAACAGAAGG + Intronic
1098820379 12:75220246-75220268 TTGTGAATGAATAAAATTGAAGG - Intergenic
1098944927 12:76579500-76579522 TTGAGAAAGAACAAAACTGGAGG + Intergenic
1099361147 12:81703385-81703407 TTGAGGAAGAATAAAAATCAAGG - Intronic
1100043472 12:90348749-90348771 TTAAGTATGAAGAAAACTGAAGG + Intergenic
1100061208 12:90577994-90578016 TGCAAAAGGAATAAAACTGGAGG + Intergenic
1100419016 12:94411696-94411718 TTTAGAAGAAATGAAACTGCAGG - Exonic
1101036666 12:100714627-100714649 TGGAGAATGAATAAAACATAAGG + Intergenic
1101361298 12:104030041-104030063 TTGAGCAGGAACAAAACTGAAGG + Intronic
1103247547 12:119470951-119470973 TGGAGAACAAATAAAATTGATGG + Intronic
1105482672 13:20793261-20793283 TTCAGAAGAAACAAAAATGAAGG - Intronic
1106279028 13:28246515-28246537 GTTAGAAGGAATAAGACTTAGGG - Intronic
1106998064 13:35510616-35510638 TTGCAAAGGAATAAAAAAGAAGG + Intronic
1107031661 13:35860293-35860315 TTGAGAAGGAAAAAAAATGCAGG + Intronic
1107347913 13:39482704-39482726 ATGAGAAGGAATACCACTGGAGG + Intronic
1108103237 13:46980700-46980722 TTGAGAAAGAACAAAACTAGAGG + Intergenic
1108397641 13:50005686-50005708 GAGAGAAGGCATAAAACTAAAGG + Intronic
1108423043 13:50270470-50270492 TTGAGAGGGAATAAAATTTATGG - Intronic
1108868783 13:54956408-54956430 TTGATAAAGAACAAAGCTGAAGG - Intergenic
1109089832 13:58027969-58027991 TATGAAAGGAATAAAACTGACGG - Intergenic
1109144960 13:58768126-58768148 TTAAGAAAGAATAAATCTGTAGG - Intergenic
1109843083 13:67946979-67947001 TTGAGGGGGGATAAAACTGAGGG - Intergenic
1110201582 13:72856782-72856804 TTAAGAAAGAATTAAACTGATGG - Intronic
1110909868 13:80944825-80944847 TTGACAAGAAATAAAAGTGTGGG - Intergenic
1110916229 13:81024461-81024483 CTAAGAAGAAATAAAATTGATGG + Intergenic
1111308867 13:86454425-86454447 GGGAGAAGGAGTAAAAATGAAGG + Intergenic
1111408650 13:87845009-87845031 TGGAGAAGGTATAAGACAGAGGG + Intergenic
1111590009 13:90334241-90334263 TTGATAAAAAATAAAATTGATGG - Intergenic
1111960684 13:94806728-94806750 CTGAGAAGAAATAAAACGAAAGG - Intergenic
1113217242 13:108056520-108056542 TTAAAAAGGAAGAAAACAGATGG + Intergenic
1113235639 13:108269949-108269971 AAGAGAAGAAATGAAACTGAAGG + Exonic
1113682876 13:112256525-112256547 ATCATAAGGAATAAAACAGAAGG + Intergenic
1113683809 13:112263816-112263838 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114811448 14:25905184-25905206 TTGAACAGGAAAAAAAATGAAGG + Intergenic
1115033103 14:28822097-28822119 TTGAGAAAGAATAAAAAAGCTGG + Intergenic
1115101546 14:29707261-29707283 ATGAGAGGGAACAAAACTGGAGG + Intronic
1115295767 14:31825148-31825170 TTTGGTGGGAATAAAACTGAGGG - Intronic
1115946721 14:38669959-38669981 TTTAGAAGGAAGAAAGGTGAAGG - Intergenic
1116201577 14:41804159-41804181 TTGAGTAGTAATAAAACTCTGGG - Intronic
1116242929 14:42369890-42369912 TTGAGAGGGAATAAAATGGGAGG - Intergenic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1117178827 14:53172045-53172067 TTGAGAAGTAGGAAGACTGAGGG + Intergenic
1117237529 14:53794384-53794406 CAGAGCAGGAATCAAACTGATGG + Intergenic
1117627907 14:57659101-57659123 CTGAGAAAGTAGAAAACTGAAGG - Intronic
1117917135 14:60689629-60689651 GGGAGAAGAAATAAGACTGAAGG - Intergenic
1117940489 14:60959091-60959113 TTGGGAAGGCAGAAAACTGTGGG + Intronic
1118295407 14:64563702-64563724 TAGAGAATGAATAAAGTTGAGGG + Intronic
1118363110 14:65072305-65072327 TTGAGAAGGAAGAAAGCTGAGGG - Intronic
1118516559 14:66535401-66535423 TGAAGAAGAAATAAAATTGAAGG - Intronic
1119153099 14:72383699-72383721 TTGAGAAAGAGTAAAACAGAAGG - Intronic
1119526495 14:75326822-75326844 TTGAGAGAGGAGAAAACTGAGGG - Intergenic
1120115995 14:80618197-80618219 ATGATATGGAATAAAATTGATGG - Intronic
1121232552 14:92368541-92368563 CTGAGAAGGAATGAAGATGAGGG - Intronic
1121896468 14:97652739-97652761 TTGAGAAATAATCAAACTTATGG + Intergenic
1202843034 14_GL000009v2_random:141173-141195 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1202912436 14_GL000194v1_random:131424-131446 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1202880201 14_KI270722v1_random:51220-51242 TTGAGAAGGAATAAAAGATTTGG + Intergenic
1124531162 15:30508025-30508047 TTTAGAAGTAAAAAAACTTAAGG + Intergenic
1124767493 15:32499671-32499693 TTTAGAAGTAAAAAAACTTAAGG - Intergenic
1125086974 15:35741317-35741339 TTCATAAAGAATAAAACAGATGG + Intergenic
1125181581 15:36885684-36885706 TTAAGAAGAAATAATAATGAAGG - Intergenic
1125425658 15:39546434-39546456 TTGAGAAAGAACAAAGCTGGAGG + Intergenic
1126747163 15:51837736-51837758 TTGACAAGGAATAATAATGGGGG - Intronic
1127036008 15:54918300-54918322 TAGAGAAGGTACAAAATTGAAGG - Intergenic
1127229111 15:56969430-56969452 TTGAGAATGAAGAAAACTGGAGG + Intronic
1127442478 15:59023779-59023801 TTCAGGGGGAAAAAAACTGATGG - Intronic
1129961485 15:79690749-79690771 TTGAGAAAGAATAACACTGTAGG + Intergenic
1130850437 15:87788183-87788205 TAGAGTAGGTATAAAAGTGATGG - Intergenic
1132356038 15:101172039-101172061 TTCAGAATGAATGAATCTGAAGG + Intergenic
1132529094 16:435999-436021 TGGAGAAGGAAAAAAAGAGATGG + Intronic
1133509633 16:6444952-6444974 TTGAGGGAGAGTAAAACTGATGG + Intronic
1133849574 16:9489466-9489488 ATGGGAAGGGATAAAATTGATGG - Intergenic
1133881149 16:9783666-9783688 AAGAGAATGAATAAAACTCAGGG + Intronic
1134235863 16:12465642-12465664 TTGAGAAAGAACAAAGCTGGAGG - Intronic
1135228653 16:20683937-20683959 TCAAGAAGTAATAAAACTGGTGG - Intronic
1137235898 16:46617777-46617799 TTGAGAATGCATAAAGCAGAGGG + Intronic
1137429003 16:48403241-48403263 TTAACAAAGAATAAAAATGAGGG - Intronic
1138074494 16:54027479-54027501 AAGAAAAGGAATAAAAATGAGGG - Intronic
1139010384 16:62624660-62624682 TTAAGAAGAAAGAAAACTCATGG - Intergenic
1139897399 16:70298647-70298669 TTAAAAAGGAAGAAAACAGACGG - Intronic
1140953801 16:79844240-79844262 TTGATTAGGAAAGAAACTGATGG + Intergenic
1141612422 16:85189710-85189732 TTAAGAAGAAATAAACCTCATGG - Intergenic
1141688706 16:85584674-85584696 TTAAAAAGGCATAAAACGGAGGG - Intergenic
1145184021 17:20778871-20778893 TTGAGAAAGAACAAAGTTGAAGG - Intergenic
1145706765 17:26878330-26878352 ATGGGAAGGAATGAAACTGAAGG + Intergenic
1147269903 17:39261780-39261802 TTGTGTAATAATAAAACTGAGGG + Intronic
1147276055 17:39317585-39317607 TAAAGAAGGAAAAAAAATGATGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148739133 17:49881945-49881967 TTTAAAATGAATAAAACTTAAGG - Intergenic
1149101165 17:52908841-52908863 TCATGAATGAATAAAACTGAAGG - Intergenic
1149107257 17:52984396-52984418 CTGAGAGGGAATAAAACAAAGGG - Intergenic
1150037908 17:61824364-61824386 TTGAAAAAGAACAAAACTGGAGG + Intronic
1150164227 17:62926245-62926267 TCCAGAAGGAAAAAAACTGCAGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150856393 17:68757262-68757284 CTTAGAAGGAATAAAACTACTGG - Intergenic
1153754745 18:8269588-8269610 TTAAGAAAGAATAAAACTATAGG + Intronic
1155590383 18:27420737-27420759 TGGAGATGGAAGAAAAATGATGG + Intergenic
1157958467 18:52125683-52125705 TTGAAAAGGGAGAAAATTGAAGG + Intergenic
1158048233 18:53183153-53183175 TTTGCAAAGAATAAAACTGATGG + Intronic
1158423409 18:57315956-57315978 TTGATCAAGAACAAAACTGAAGG - Intergenic
1158512913 18:58107371-58107393 TTTGGAAGGATTAGAACTGATGG + Intronic
1158873793 18:61713534-61713556 TTCAGAAGAAATAAAAGGGATGG + Intergenic
1158922545 18:62209557-62209579 TTGAAAAGGAATAAAGATGGAGG - Intronic
1159432364 18:68369644-68369666 TTGAGAAAAAACAAAGCTGAGGG + Intergenic
1159510732 18:69395648-69395670 TTGAAAAGGGAGAAAACAGAAGG + Intergenic
1160717484 19:582920-582942 TTCAGAAGGAAAAAAACCTAAGG - Exonic
1162208148 19:9071248-9071270 TTGGGAAGGAATTCAGCTGATGG + Intergenic
1164005864 19:21148550-21148572 ATTAGATAGAATAAAACTGAAGG - Intronic
1164665133 19:30025658-30025680 TTGAAAAAGAACAAAATTGAAGG - Intergenic
1164879337 19:31717848-31717870 TTGAGAGGGAAAAAGACAGAGGG + Intergenic
1165142436 19:33708664-33708686 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1166900815 19:46061144-46061166 TTAAGATAGAATAAAGCTGAAGG - Intronic
1202655813 1_KI270708v1_random:20312-20334 TTGAGAAGGAATAAAAGGTTTGG + Intergenic
925650296 2:6082245-6082267 TTTAGAGGAAATAAAACTGGGGG - Intergenic
925652950 2:6111571-6111593 TAGATATGGCATAAAACTGATGG - Intergenic
925840371 2:7986268-7986290 GTGTGGAGGAAGAAAACTGATGG + Intergenic
926576279 2:14585735-14585757 TTAAGAAAGAACAAAAGTGAGGG - Intergenic
927289163 2:21388116-21388138 ATGAGAAGGAATAAAACTTCAGG + Intergenic
927425641 2:22978630-22978652 GAGAGAAGGAAGAAAAATGAAGG + Intergenic
927867983 2:26604785-26604807 TTGAAAAGGATTCAAAATGAGGG - Intronic
927947343 2:27144150-27144172 TTGACAAGGAATAAAGGAGAGGG - Intergenic
928271821 2:29862820-29862842 TTGAGAAAAAAAAAAACTGGGGG + Intronic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
929763779 2:44827571-44827593 TAGAGAAAGAATAAAACGGAAGG - Intergenic
930528305 2:52559509-52559531 GTGAAAAGAAATAAAAATGAAGG - Intergenic
931017928 2:58007065-58007087 CTGAGAAGGAAGAATATTGATGG - Intronic
931159724 2:59675451-59675473 TAGAGAGGGAATAAAACAAAGGG + Intergenic
931482563 2:62656611-62656633 TTGGGAAGGAAGAATTCTGAAGG + Intergenic
931692371 2:64846139-64846161 TTCAGAAGTAATAAAGATGATGG - Intergenic
932381268 2:71285682-71285704 TTGAGAAAGAACAAAGCTGTTGG + Intronic
932830085 2:74980892-74980914 TTCAGAGGGAATTAAATTGAAGG - Intergenic
933318989 2:80748266-80748288 TTGAACAGTAATAAAACAGATGG + Intergenic
933697711 2:85232374-85232396 TAGATAATGAATAAATCTGAGGG - Intronic
934140692 2:89044488-89044510 TTGACAAGGAAGAAAACGGTGGG - Intergenic
934168272 2:89316884-89316906 CTCAGAAGAAACAAAACTGAAGG - Intergenic
934199015 2:89865698-89865720 CTCAGAAGAAACAAAACTGAAGG + Intergenic
934228545 2:90156054-90156076 TTGACAAGGAAGAAAACGGTGGG + Intergenic
935065523 2:99643910-99643932 TTGAGAAAGGGCAAAACTGAGGG + Intronic
935448161 2:103178774-103178796 TTGTGAAGGAAAAAAAGTGAAGG - Intergenic
935517853 2:104065670-104065692 TTGAAAAAGAATAAAGTTGAAGG + Intergenic
937135844 2:119551690-119551712 TTGAAAAAGAACAAAACTGGAGG - Intronic
937141625 2:119606640-119606662 TAGAGAAGGAAAAAAAATCACGG + Intronic
937726376 2:125172426-125172448 TTTACAAATAATAAAACTGAGGG - Intergenic
938259587 2:129885733-129885755 TTGAGAAGGCAGAAAAGAGATGG + Intergenic
938811545 2:134857875-134857897 TATAGAAGGAATAAAGCTGTGGG - Intronic
939028435 2:137042117-137042139 TTCACAAGGAATAAATGTGAAGG - Intronic
939106766 2:137957620-137957642 TTGAGAAGGAAGAGAGCAGATGG - Intergenic
939320639 2:140615737-140615759 TTGAGAAGGTATTTATCTGAGGG - Intronic
939627814 2:144499899-144499921 TTTAGAAAGTAAAAAACTGATGG + Intronic
939646410 2:144704754-144704776 TTGATAGGGAATAAAAGGGATGG + Intergenic
939678517 2:145102027-145102049 TTGAAAAGGAACAAAGTTGAGGG + Intergenic
940338508 2:152554621-152554643 TTGAGAAGCTGTCAAACTGACGG + Intronic
940490771 2:154357004-154357026 TTGAAATGAAATAAAACTGTGGG + Intronic
940688107 2:156879860-156879882 ATGAGAAGTAATATATCTGAAGG + Intergenic
940710149 2:157153168-157153190 TTCAAAAGGAATAAAACTACAGG + Intergenic
941260736 2:163293315-163293337 TGCAAAAGGAGTAAAACTGAAGG + Intergenic
941578673 2:167268150-167268172 TGGTAAATGAATAAAACTGAAGG - Intergenic
942024398 2:171897953-171897975 TTGAGAAGGAACAAAGTTGGAGG + Intronic
943166663 2:184336166-184336188 TTGAGAATAAATAAAAATCAAGG - Intergenic
943281320 2:185937376-185937398 ATGCGGAAGAATAAAACTGATGG - Intergenic
943307202 2:186277789-186277811 ATGAGAAGGAATTCCACTGAGGG - Intergenic
943964490 2:194315508-194315530 TTGAGAAAGAATAAAGGTGAAGG - Intergenic
944003311 2:194869152-194869174 TGGAGAAGGAATACAAATGAGGG + Intergenic
944432546 2:199649373-199649395 TCGAGAAGGAATAAAACTGGAGG - Intergenic
944755033 2:202752506-202752528 TTATCAGGGAATAAAACTGATGG + Intronic
946082275 2:217132064-217132086 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
946189824 2:218002332-218002354 TGTAGAAGGAATAAAAGGGATGG + Intronic
947508984 2:230733459-230733481 TTGAGAAGGAAGAAAAGTCAAGG - Intronic
947939869 2:234043407-234043429 TTCAGAAAGAACAAAACTGGAGG + Intergenic
1169938709 20:10913497-10913519 TTGACAAGGAACAAAATTGCAGG + Intergenic
1170014001 20:11760191-11760213 CTGAGAAAGAACAAAGCTGAAGG - Intergenic
1170583591 20:17717022-17717044 TAGAGAAAGAATGAAAATGAGGG - Intronic
1170748945 20:19127149-19127171 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1171516048 20:25737238-25737260 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1172350677 20:34237169-34237191 TTGAAAAAGAATAAAGCTGGAGG - Intronic
1172761071 20:37322607-37322629 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1173082956 20:39887119-39887141 TGAAGAAGCAACAAAACTGAGGG - Intergenic
1173205114 20:40986696-40986718 TTGAGATGAAATAGAAATGAGGG + Intergenic
1174811003 20:53645788-53645810 TTGATAAGTAATAAAACTTTGGG + Intergenic
1174926274 20:54763375-54763397 TTCAGAAGGAAGGAAACTGTAGG + Intergenic
1176631792 21:9146097-9146119 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1176641510 21:9308755-9308777 TTGAGAAGGAATAAAAGGCTTGG + Intergenic
1177184420 21:17777765-17777787 GTGAGAAGGAATAGAACTAAGGG + Intergenic
1178138301 21:29653496-29653518 TTGAGAAGGAATACGAATAATGG - Intronic
1178314329 21:31556773-31556795 TAGAGGAGAAATAAAACTTAAGG - Intronic
1178847811 21:36187956-36187978 TTGAGTAGGAGTAGAACTGAAGG - Intronic
1179325791 21:40343273-40343295 TTGAGTAGAAATAAAATGGATGG - Intronic
1180350529 22:11798112-11798134 TTGAGAAGGAATAAAAGGCTTGG + Intergenic
1180374809 22:12081521-12081543 TTGAGAAGGAATAAAAGGTTTGG + Intergenic
1180387682 22:12193952-12193974 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1181916897 22:26288668-26288690 TTGAGAAGGAATTAAAAAGGAGG + Intronic
1181918652 22:26301701-26301723 TTGAGTAGGAAATAGACTGAGGG + Intronic
1182481843 22:30614326-30614348 CTGAGAGGGAAAAAAACAGAGGG - Intronic
1182934076 22:34204165-34204187 TTGACAAGAAATAGAAATGAAGG + Intergenic
1183164347 22:36136189-36136211 TTTAGAAGGAATAAATCTGGAGG + Intergenic
1184965940 22:47972392-47972414 TTGAGAAGGATTATTGCTGAGGG + Intergenic
949219490 3:1613702-1613724 TGGAGGAGGAATAATTCTGAAGG - Intergenic
949323775 3:2840998-2841020 TAGAGAAGGAGAAAAGCTGATGG - Intronic
949605516 3:5648672-5648694 TTAAGATGGAAGAAAACAGAGGG + Intergenic
949744564 3:7274324-7274346 TGGAGAAGGACTAAAAGTGAAGG - Intronic
949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG + Intergenic
950299024 3:11858333-11858355 TTGAAAAAGAATAAAATAGAAGG - Intergenic
950825754 3:15818946-15818968 TTGAAAATCAATAAAATTGAGGG + Intronic
951368146 3:21810618-21810640 TAGAGAAGGAATGAATCAGATGG + Intronic
951371300 3:21852691-21852713 TTGACAAAGAATAAAATTGGGGG + Intronic
951401187 3:22233138-22233160 TTGAGATAGAAAAAATCTGAAGG - Intronic
951636232 3:24780904-24780926 TAAAGTAGGAAAAAAACTGAAGG - Intergenic
951711582 3:25589490-25589512 TCGAGCAGGAATAGAAATGAAGG + Intronic
951716735 3:25656892-25656914 TTAAGCTAGAATAAAACTGAAGG + Intronic
952086884 3:29833181-29833203 TGGTGAAGGATTAAAACTGAAGG + Intronic
954102490 3:48386430-48386452 TTGAGAAAGAATAAAGCTGGAGG - Intronic
954631340 3:52049371-52049393 TGGAGAAGGAACAAAACTGGAGG + Exonic
954738943 3:52731369-52731391 TTGAGAAAGAATAATAGTGGAGG + Intronic
955844730 3:63150237-63150259 TTAAGAAGTAATAAAAATGGTGG + Intergenic
956273894 3:67477112-67477134 TTGAGAAGGAGTGATACAGAGGG - Intronic
956315669 3:67933829-67933851 GTGAGAAGGAAGAAAGTTGAAGG + Intergenic
957133542 3:76254751-76254773 GAGAGAACAAATAAAACTGAGGG + Intronic
958424659 3:93966440-93966462 TTGAGAGGAAACATAACTGATGG - Intronic
958805190 3:98801632-98801654 TCCAGAAAGAAAAAAACTGAAGG - Exonic
958848684 3:99295945-99295967 TAGAGAAGGAATAAAAAAGGGGG + Intergenic
959266263 3:104142820-104142842 TTAAAAAGGAACAAAACTGCTGG - Intergenic
959547218 3:107611323-107611345 ATTTGAAGGAATAAAACTCATGG - Intronic
959959535 3:112281616-112281638 CAGGGAAGGAATAAAAGTGAAGG + Intronic
960207735 3:114923274-114923296 TTGAAAAGGAACAAAGCTGGAGG + Intronic
960219892 3:115094035-115094057 ATGTGAAGGGATAAAGCTGAGGG - Intronic
960613632 3:119577774-119577796 TTCAGAAAGGGTAAAACTGAGGG + Intergenic
960724988 3:120661054-120661076 TTTAGAAGTGAAAAAACTGATGG + Intronic
960902675 3:122567484-122567506 TTGAGAAGGAACAAAACATTAGG + Intronic
961237791 3:125383089-125383111 TTAAAAAGCAATAAATCTGAGGG + Intergenic
961723898 3:128913294-128913316 CTGAGAAGGATAAAAACTAAGGG - Intronic
962938408 3:140102944-140102966 TTGAAAGGTAAGAAAACTGAGGG - Intronic
963028744 3:140945356-140945378 TTTAGAAGGAAAAAAAGGGAAGG - Intronic
963562366 3:146881982-146882004 TTGAAAAAGAATACAATTGAGGG - Intergenic
964141730 3:153410033-153410055 TTAATCTGGAATAAAACTGAGGG - Intergenic
964372286 3:156012932-156012954 TTGAAAAAGAATAAAATTGGAGG + Intergenic
964758593 3:160111956-160111978 ATGAGAAAAAAAAAAACTGATGG + Intergenic
964863609 3:161229672-161229694 TAGAGAAGGAAAGAAACTGGAGG + Intronic
965176224 3:165336858-165336880 TTGTAAAGTAATAAAACAGAAGG - Intergenic
966958890 3:184913282-184913304 TGTAGAAGGAATAGATCTGAGGG - Intronic
967213378 3:187188791-187188813 TTTAGAAGACATATAACTGATGG + Intergenic
967662612 3:192131728-192131750 TTGAGAAGAAGAAAAACTAAGGG + Intergenic
968282590 3:197488529-197488551 TTAAGAAGGAATAAAAGGTAAGG + Intergenic
1202745385 3_GL000221v1_random:96263-96285 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
968406932 4:348756-348778 TTGAGAAAGAACAAAGCTGGGGG - Intronic
969935539 4:10676796-10676818 AGGAGAAGGAAGAAAAATGAAGG - Intronic
970978150 4:22065301-22065323 TTGAGAAGAAAACAAAATGAAGG - Intergenic
971789743 4:31154210-31154232 TAGAGAAGGAATGAACATGAAGG + Intergenic
973083130 4:46020048-46020070 TTGAGATGTAATAAAAATAATGG - Intergenic
973352610 4:49112066-49112088 ATGGAAAGGAATCAAACTGAAGG - Intergenic
974186450 4:58453906-58453928 TTGAGAAGTAATAATAGTGGTGG - Intergenic
974475724 4:62377195-62377217 TTAAGAAAGAATAATACAGAAGG + Intergenic
974564149 4:63562534-63562556 TTAGGAAGGAAAAAAAATGATGG + Intergenic
974759752 4:66259642-66259664 TTGAGATGGAATGATACTGGAGG - Intergenic
975184883 4:71389752-71389774 TTGTGAATGAATAATAGTGATGG - Intronic
976030939 4:80752191-80752213 TGGAGAAGGAAGAAAAGTGAAGG - Intronic
976385422 4:84451838-84451860 TTGAAAGGCAATAAAATTGAGGG + Intergenic
976571914 4:86622102-86622124 TTCAGAAGGAAGAAAACACAGGG - Intronic
976780518 4:88753315-88753337 TTAACAAAGAAGAAAACTGATGG - Intronic
976934462 4:90612393-90612415 ATGAGAAAGGCTAAAACTGATGG - Intronic
976954908 4:90883770-90883792 TTCAGATGGAATATATCTGAAGG + Intronic
977829632 4:101575652-101575674 TTGAGGAGGAAACAAACAGATGG - Intronic
978601948 4:110437837-110437859 CTGAAAAGGAATAAAACAGAGGG + Intronic
979778669 4:124622572-124622594 ATGAGAAGGCATAAATTTGAGGG - Intergenic
979908700 4:126332660-126332682 TTTAGAAGAAATAAAAATCAAGG + Intergenic
980213320 4:129817815-129817837 TTGAGAAGAAATGAATGTGAGGG - Intergenic
980477761 4:133340868-133340890 TTGAGAAAGAATAAATATGGAGG - Intergenic
980480318 4:133379333-133379355 TAGATAAGGAATACAAATGAAGG - Intergenic
980684268 4:136205033-136205055 GTTAGAATGAATAAAAATGACGG + Intergenic
980712355 4:136586104-136586126 TTGTGAAGGAAAAATAATGAAGG - Intergenic
980775706 4:137433498-137433520 TTGAGAAGGAAGAAAACAAGAGG + Intergenic
980794161 4:137659332-137659354 TTGAAAAGGAATAAATAAGAAGG - Intergenic
980814723 4:137929630-137929652 CTGAGACAGAATAAAACTAAAGG + Intergenic
981143216 4:141294943-141294965 TTTAGAAGAAATCAAAATGATGG + Intergenic
981360773 4:143843303-143843325 CTGAGAGGGAGGAAAACTGAGGG + Intergenic
981380614 4:144067567-144067589 CTGAGAGGGAGGAAAACTGAGGG + Intergenic
981596011 4:146423327-146423349 CTAAGAAGAAATAGAACTGAAGG - Intronic
981805316 4:148708511-148708533 CTAAGAAGGAAAAAACCTGAGGG + Intergenic
982342633 4:154318900-154318922 TTGAGAAAGAACAAAGCTGGAGG + Intronic
982367837 4:154599335-154599357 TTGAGAAGGAAAAAAACACCAGG - Intergenic
983224965 4:165077352-165077374 TTGAAAAGAAAAACAACTGAAGG + Exonic
983748903 4:171238464-171238486 TTTAGGAGTCATAAAACTGAAGG - Intergenic
983950947 4:173640794-173640816 TTGAGAAAGAACAAAGCTGGTGG + Intergenic
984656378 4:182323020-182323042 ATGAGAAGGAATAAAGATAAAGG + Intronic
985039154 4:185871470-185871492 TAGCGAAGGAATAAAATTCAGGG + Intronic
985059577 4:186063471-186063493 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1202756396 4_GL000008v2_random:66966-66988 TTGAGAAGGAATAAAAGGTTTGG + Intergenic
985811530 5:2093590-2093612 ATGATAAGAAATAAAAATGAGGG + Intergenic
985970990 5:3378140-3378162 TTGAGTAGGAAAATAACAGAGGG - Intergenic
987497269 5:18663668-18663690 GTGAGAACTAATTAAACTGAAGG + Intergenic
988371607 5:30376711-30376733 TTGTGAAGGAAGAAATATGATGG - Intergenic
990352478 5:54932661-54932683 CTCAGAAGGTAAAAAACTGATGG - Intergenic
990749986 5:59003989-59004011 TTGTCAAAGAATAAAATTGATGG - Intronic
992129581 5:73678248-73678270 TTTAGAAGGATTAGGACTGAGGG + Intronic
992435408 5:76751330-76751352 TTGAGTAGGAATTAGAATGAGGG - Intergenic
993798179 5:92296822-92296844 TGAAGAAAGAATAAAACAGAGGG - Intergenic
993939554 5:94042115-94042137 GTTAGATGGAATAAAGCTGAAGG + Intronic
995046125 5:107650430-107650452 TTGTGAAGGAATGAAACAAAAGG + Intronic
995088134 5:108139795-108139817 ATCAGAAGGAATTAACCTGAAGG - Intronic
995095129 5:108226905-108226927 TTGAGAAGTACAAAAACTAATGG - Intronic
996167739 5:120245912-120245934 TTGGCAAAGAATAAAATTGAAGG + Intergenic
996270684 5:121601301-121601323 TTGAGAAAGAAGAAAGCTGGAGG - Intergenic
997095691 5:130908442-130908464 TTGCTGATGAATAAAACTGATGG + Intergenic
997101420 5:130973294-130973316 GTGAAAAAGAATAAAACTAATGG - Intergenic
997404305 5:133632407-133632429 TTGAGAAAGAAGAAAAATCATGG - Intergenic
998483029 5:142478781-142478803 CTGAGATGGAGGAAAACTGAGGG - Intergenic
998909712 5:146945796-146945818 TTGAGAAAGAATGTTACTGATGG + Intronic
999000864 5:147921767-147921789 TTGAGAACGATTACAACTGTGGG - Intergenic
999876296 5:155810240-155810262 CTGACAAGAAATAAAAATGAAGG - Intergenic
1000246836 5:159455248-159455270 TTGAGAAGAAAAAAAAATGATGG + Intergenic
1002920360 6:1565279-1565301 AGGAGCAGCAATAAAACTGATGG + Intergenic
1004597668 6:17115809-17115831 TAGAGAAGAAATAACAGTGATGG - Intronic
1005089317 6:22040028-22040050 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
1005261046 6:24060709-24060731 TTGAGAAAGAATAAAGCAGGAGG + Intergenic
1005345673 6:24887624-24887646 TTGAAGAGGAATAAAAGAGAGGG - Intronic
1005717848 6:28568732-28568754 TTGAGAAAGAACCAAAGTGAGGG - Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1005995141 6:30926221-30926243 CTGAGAGGGAGGAAAACTGATGG - Exonic
1006256041 6:32832962-32832984 TCCAGAAGGAATAAGAGTGAAGG + Intronic
1008179165 6:48306376-48306398 TTGAGGAGGAATAAAAGGGGAGG - Intergenic
1008390474 6:50945453-50945475 TTTAGAAATAAGAAAACTGAGGG + Intergenic
1008482764 6:52003788-52003810 TTGAAAAGGAACAAAATTGGAGG - Intronic
1008956245 6:57219523-57219545 TTGAAAAAGAATAAAACTGGAGG + Intronic
1009040080 6:58165638-58165660 TTGAAAAGGAATAAAACAAATGG + Intergenic
1009215973 6:60920494-60920516 TTGAAAAGGAATAAAACAAATGG + Intergenic
1009440554 6:63673046-63673068 TTGAGGAGAAATAAATTTGAAGG - Intronic
1009565430 6:65306056-65306078 TTGTGAAGGAATAAGCATGATGG + Intronic
1009692734 6:67057507-67057529 TTGAATAAGAATAAAACTGGAGG - Intergenic
1009858168 6:69291147-69291169 TTGCTGAGGAATAAAAGTGAGGG + Intronic
1010293029 6:74162166-74162188 TTGAGAAGTAATAAAATTGGAGG + Intergenic
1010859787 6:80895950-80895972 TTTTAAAGAAATAAAACTGATGG - Intergenic
1010870893 6:81036890-81036912 TTGAATAGGAATATTACTGAGGG + Intergenic
1010873141 6:81066367-81066389 TTGAGAATTAATGAAACTAATGG + Intergenic
1011152726 6:84291607-84291629 TTGAGAAGGAAGAAGACTGATGG - Intergenic
1012082054 6:94771883-94771905 ACGAGAATGAATAAAAGTGAAGG + Intergenic
1012659704 6:101872602-101872624 AGGTGAAAGAATAAAACTGATGG - Intronic
1012769540 6:103413000-103413022 TTAAGAAAGAATAAAACTGTTGG - Intergenic
1013081756 6:106819004-106819026 TTAAAAGAGAATAAAACTGAAGG + Intergenic
1013602719 6:111720006-111720028 TAAAGAAGCAACAAAACTGACGG - Exonic
1013830057 6:114261152-114261174 TTGGGTAGGAAAAAAAATGAGGG + Intronic
1013857776 6:114594923-114594945 TGGAGCAAGAATAAAAATGAAGG - Intergenic
1014308039 6:119766608-119766630 TTGTGGAGGTAGAAAACTGAAGG - Intergenic
1014678967 6:124404450-124404472 TGGAGAAGGAAAGAAACTCAGGG - Intronic
1014966536 6:127760322-127760344 TTGAGAAAGAATAAAGCTGGAGG - Intronic
1015002803 6:128240265-128240287 ATCAGAAAGAAGAAAACTGAGGG + Intronic
1015377662 6:132528946-132528968 TTTAGAAAGGATAAAGCTGAAGG + Intergenic
1016011941 6:139146173-139146195 TTATGAAGGAATAAATCTTAAGG - Intronic
1016285891 6:142472751-142472773 TTGAGAAAGGACAAAACTGGAGG + Intergenic
1016527142 6:145014563-145014585 TTGAAAAGGAGGTAAACTGAGGG + Intergenic
1017154252 6:151308726-151308748 TAGAGAAAGAAAAAAACAGAAGG - Intronic
1017762868 6:157584512-157584534 TGGGGCAGGAATAAATCTGATGG + Intronic
1019087712 6:169496990-169497012 TTGAAAAAGAACAAAACTGGAGG + Intronic
1020597220 7:10223061-10223083 TTGAGAAAGAAAAAAACTTATGG + Intergenic
1020613636 7:10431628-10431650 TAGAGAATGGATAAATCTGATGG - Intergenic
1020824018 7:13004498-13004520 TTGAGCAAGAACAAAGCTGAAGG - Intergenic
1021045985 7:15923957-15923979 TTGAGAAAGAACAAAGCTGGGGG + Intergenic
1021750301 7:23792662-23792684 TTGAAAAAGAACAAAATTGAAGG + Intronic
1021773406 7:24027777-24027799 TTGGTAAGGAAAAAAAATGAAGG - Intergenic
1022545939 7:31189102-31189124 TTGAGAAAGAAGAAAACTGCTGG - Intergenic
1022581788 7:31562739-31562761 ATGAGAAGGAATAAGACTAGAGG - Intronic
1022899548 7:34791750-34791772 TTGAGAAAGAACAAAGCTCAAGG + Intronic
1022995224 7:35748447-35748469 TTGGGAAGGAAAGAAACTAAAGG + Intergenic
1023383594 7:39632964-39632986 TAGAGAAGCAAGAAAACTCAGGG - Intronic
1023407542 7:39850647-39850669 TTAAAAAGGAAGAAAACTGAAGG - Intergenic
1023664409 7:42506856-42506878 TTCAGAAAGACTAAAACTAAAGG - Intergenic
1023788403 7:43731462-43731484 ATCACAAGGAATAAAACTGATGG + Intergenic
1023933456 7:44722031-44722053 GTTAGATGGAATAAAGCTGAAGG - Intergenic
1024501750 7:50117167-50117189 TTTGGAAGTCATAAAACTGAAGG - Intronic
1024808157 7:53173617-53173639 TTGAGAAGGAATAAAGCTGGGGG - Intergenic
1025621861 7:63180332-63180354 TTGAAAAGGAATAAAATGGAGGG + Intergenic
1025799544 7:64772713-64772735 TTGAGAAAGAACAAAGCTGGGGG - Intergenic
1026030204 7:66786065-66786087 TTTAGAAAGAATAATACTGTGGG - Intronic
1026444777 7:70474722-70474744 CTGACAGGGAATAAAACTAAAGG - Intronic
1026556744 7:71415000-71415022 TTAAGAATAAATAAAACTAAAGG - Intronic
1027516119 7:79144428-79144450 TGGAGCAGGAATAAGACAGAAGG - Intronic
1027640466 7:80727231-80727253 TGCAGAAGTGATAAAACTGATGG + Intergenic
1027932758 7:84560182-84560204 TTGAGAAAGAATAAAGCTAGAGG + Intergenic
1028826675 7:95281585-95281607 TTGAAAAGAAAAAAATCTGAAGG - Intronic
1030340308 7:108371920-108371942 TTGAGAAAGAACAAAGCTGGAGG + Intronic
1030487212 7:110184685-110184707 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1030800905 7:113850418-113850440 TTGTGAAGGAATAAACTTGTTGG - Intergenic
1030812802 7:113996105-113996127 TTGAGAAAGAATGAAGCTGGAGG + Intronic
1031141332 7:117946745-117946767 TTGAGAAGGAATGAAAGCAAAGG - Intergenic
1031790189 7:126092868-126092890 TTGTGAATACATAAAACTGAAGG + Intergenic
1031929994 7:127675217-127675239 TTAATAAGGAAAAAAAATGAAGG - Intronic
1032991261 7:137397034-137397056 TTGAGAAAGAATAAATGTGATGG + Intronic
1033065893 7:138153603-138153625 TTGAAAAAGAATAATAGTGAGGG - Intergenic
1033144582 7:138860528-138860550 TGGAGAAGAAGTAAAACTCAAGG - Intronic
1033632018 7:143167883-143167905 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1033999760 7:147398886-147398908 GTGAGAAGGAATAAATTTTATGG + Intronic
1034731883 7:153394292-153394314 GTTAGAAAGCATAAAACTGAAGG + Intergenic
1034851448 7:154497779-154497801 CTGGGAAGGAATAAAACAAAGGG + Intronic
1035091097 7:156311443-156311465 TTGAGCAAGAACAAAACTGAAGG - Intergenic
1035164348 7:156976225-156976247 TTGAGAAAGAACAAAGCTGAAGG - Intergenic
1036547888 8:9789771-9789793 TTGAGAAAGAATAAAAATAAAGG + Intergenic
1036642349 8:10592308-10592330 TTAATAAGGAACAAAATTGAGGG + Intergenic
1037460645 8:19105118-19105140 TTGAAATGGGATGAAACTGAAGG + Intergenic
1037719147 8:21428090-21428112 TGAAATAGGAATAAAACTGAAGG - Intergenic
1038039077 8:23709112-23709134 TTGACAAGGATGAAAATTGAAGG - Intergenic
1038194522 8:25354628-25354650 ATAAGAAGGAAAAAAAGTGAGGG + Intronic
1039299098 8:36190229-36190251 TTTAGAAAGAATAAAAATGTAGG - Intergenic
1039578748 8:38646690-38646712 TTGGGAAGGCAAAACACTGAAGG - Intergenic
1040086115 8:43344322-43344344 TTAAAAAAGAAGAAAACTGAAGG - Intergenic
1040745981 8:50643070-50643092 ATGAGAAGGAGTAAAACCCAAGG - Intronic
1040761989 8:50858416-50858438 TTGAGAAAGAATAAAGCTGGAGG - Intergenic
1041069139 8:54109811-54109833 TTGAGAAAGAACAAAGCTGGAGG - Intergenic
1041510598 8:58651038-58651060 TTAAGAAGGTATACATCTGAAGG - Intronic
1041868154 8:62600423-62600445 TTAAAATGGAAAAAAACTGATGG - Intronic
1042966489 8:74359065-74359087 TCGAAAAAGAATAAAAGTGAAGG - Intronic
1043166736 8:76911714-76911736 TTGAGAAAGAGTATAACAGAGGG - Intergenic
1043450772 8:80363946-80363968 CTGAAATGGAAGAAAACTGAGGG + Intergenic
1043632485 8:82353557-82353579 TTCAGAGGGAAAAAAAATGAAGG - Intergenic
1044048428 8:87467368-87467390 TTGAAAAAGAACAAAACTGGAGG + Intronic
1044110827 8:88271264-88271286 TTACTAAGGAATAACACTGATGG + Intronic
1044175535 8:89116276-89116298 TTGAGTAACAACAAAACTGAGGG + Intergenic
1045123198 8:99061109-99061131 TTGAGATGGCATAAAACTGAAGG - Intronic
1045132302 8:99166764-99166786 TTGAAAAAGAACAAAGCTGAAGG + Intronic
1045494279 8:102695267-102695289 TTCAGAAGGAATAGAAATGATGG + Intergenic
1045812022 8:106232715-106232737 TTGAGAACCAAGAAAGCTGATGG - Intergenic
1046421742 8:113994055-113994077 TTCAGAAGAAATAAAAAAGAGGG - Intergenic
1046676957 8:117120169-117120191 TTGAGAAAAAACAAAAATGAAGG + Intronic
1046802897 8:118448705-118448727 TTGAAAAAGAAAAAAATTGAGGG - Intronic
1047180868 8:122586475-122586497 ATGAGAAAGAATGAATCTGAGGG - Intergenic
1047238713 8:123065570-123065592 TTAAGAAGAAATGAAAGTGATGG + Intronic
1047290135 8:123522690-123522712 ATGGGAAGGAACAAAAGTGAAGG - Intronic
1047290633 8:123526633-123526655 TTGAGTAGGAGTAGAACTTAGGG - Intronic
1047828698 8:128608201-128608223 TTGAGAACCAGGAAAACTGATGG - Intergenic
1047857086 8:128922515-128922537 TTGAGAAGAAAGCAAAGTGAAGG - Intergenic
1048010037 8:130448142-130448164 TTCATAAGGAATTAAACTCAGGG - Intergenic
1048058734 8:130895229-130895251 TTGGGGAGTCATAAAACTGAGGG - Intronic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048340674 8:133536411-133536433 TTGAGAAGGGATCAATCTGTAGG + Intronic
1048748567 8:137644318-137644340 TTGATAAGTGATAACACTGATGG - Intergenic
1048800863 8:138192757-138192779 TTGAGTAACAATAAAACTCAGGG + Intronic
1048953729 8:139517007-139517029 TTGTGAAGAAATAAAACTTCAGG - Intergenic
1050747200 9:8890250-8890272 TTGAGAATGAAAAATACAGAAGG + Intronic
1050868308 9:10532846-10532868 ATGAGGAGCCATAAAACTGAGGG - Intronic
1051054332 9:12966026-12966048 ATTAGAATGACTAAAACTGAAGG + Intergenic
1051251723 9:15166051-15166073 CTAAGCAGCAATAAAACTGAAGG + Exonic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051389801 9:16551969-16551991 TTCAGAAGGTAGAAATCTGAAGG + Intronic
1051391636 9:16571516-16571538 TTGCAAAGGAAAAAAACTGCAGG - Intronic
1051567192 9:18513931-18513953 TTGAGAGAGAACAAAGCTGAAGG - Intronic
1052501597 9:29298681-29298703 TGGAGAAGGAACAAAACTGGAGG + Intergenic
1053372416 9:37574155-37574177 TTTGGCAGGGATAAAACTGAGGG - Intronic
1055048282 9:71953619-71953641 TTGAGAGGCAATAAATCTGGTGG - Intronic
1055255440 9:74364686-74364708 TTCAGAAGGAAATAAAGTGATGG - Intergenic
1055915878 9:81399733-81399755 ATCAGAAGAAATATAACTGAAGG + Intergenic
1056543364 9:87593125-87593147 TGGAGACTGAATACAACTGAGGG - Intronic
1056851666 9:90089858-90089880 TTCAAAAGGAACAAACCTGAAGG - Intergenic
1057609703 9:96529826-96529848 TTGAGAAAGAATAAAAAGGTTGG - Intronic
1058002163 9:99877153-99877175 TAGAGAATGAAAGAAACTGAGGG - Intergenic
1058641499 9:107090207-107090229 TTGGGAAGGAATAAAAGACATGG + Intergenic
1059505609 9:114796999-114797021 TTGGCAAGGCAGAAAACTGAAGG + Intronic
1059905077 9:118974395-118974417 TTGAGAAAAAACAAAGCTGAAGG - Intergenic
1059915746 9:119097924-119097946 TTGAGAAAAAATAAAGCTGGAGG - Intergenic
1060077360 9:120604248-120604270 TCAAGAAGGACTAAAAATGACGG + Exonic
1060535586 9:124384564-124384586 TTGAAAAAGAATAAAACTGCAGG + Intronic
1203688002 Un_GL000214v1:14037-14059 TTGAGAAGGAATAAAAGGCTTGG + Intergenic
1203754621 Un_GL000218v1:113705-113727 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1203714007 Un_KI270742v1:126214-126236 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1203537195 Un_KI270743v1:51823-51845 TTGAGAAGGAATAAAAGGTTTGG + Intergenic
1203648273 Un_KI270751v1:90016-90038 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1186042008 X:5490825-5490847 TTGAGTAGGAAAAAAAATCAAGG + Intergenic
1186612275 X:11149120-11149142 TTAATAAGGACTAAAAATGAGGG - Intronic
1186926284 X:14336334-14336356 TTTGGAAAGAATAAAACTGAAGG + Intergenic
1187232541 X:17436272-17436294 TTGTTTAAGAATAAAACTGAAGG + Intronic
1187370128 X:18698481-18698503 ATGAGTAGGTTTAAAACTGAGGG + Intronic
1188424473 X:30030467-30030489 TTAAGAAAGACTAAATCTGAAGG + Intergenic
1188903204 X:35760597-35760619 TTGAGAAAGAATAAAGCTGAAGG + Intergenic
1190529229 X:51358297-51358319 ATGAGAAAGAAGAAAACTTAGGG + Intergenic
1191900012 X:66031163-66031185 GTGAGAAGGAATAAACAGGAGGG + Intronic
1192332639 X:70189991-70190013 TTGAGAACGAATAAAGTTAAAGG + Intronic
1193202040 X:78702968-78702990 TTGAGAAGGATTCAGACAGATGG + Intergenic
1193427185 X:81354082-81354104 TAGAGAAGAATGAAAACTGAAGG - Intergenic
1193650064 X:84120860-84120882 TTGAAAAGGAAGAAAACAGTTGG + Intronic
1193884275 X:86965047-86965069 TTAAGAAAGAACCAAACTGATGG + Intergenic
1194505680 X:94730552-94730574 TTGTGAACACATAAAACTGAAGG + Intergenic
1194740194 X:97563320-97563342 CTCTGAAGGGATAAAACTGAAGG - Intronic
1194955681 X:100177202-100177224 TTAAGAATGAATTAAGCTGAGGG - Intergenic
1195216283 X:102706831-102706853 TTGAAAAGGAAGAACACTGTTGG + Intergenic
1196217921 X:113076728-113076750 TTGAGAAAGAACAAAATTGGAGG + Intergenic
1196366125 X:114926216-114926238 TTGAGGAGGCATAAAGCAGAAGG - Intergenic
1196487751 X:116233276-116233298 ATGAGAAGAAATATAACTGTTGG - Intergenic
1196509980 X:116498391-116498413 ATGAGCAGGAAGAAATCTGAAGG - Intergenic
1196700940 X:118667641-118667663 TTGAAAAAGAATAAAGCTGGAGG - Intronic
1197317777 X:124989567-124989589 TTGACAAAGAATAATATTGAAGG + Intergenic
1197557956 X:127979598-127979620 TTGAGAAAGAATAAAATTGAAGG + Intergenic
1197563836 X:128056638-128056660 ATGGGAAAGAATAACACTGAGGG - Intergenic
1197627423 X:128817924-128817946 TTGAGAAGCAATAGTACTAAGGG + Intergenic
1197641252 X:128970646-128970668 TTGAGAAGGCAGAAAAGGGATGG - Intergenic
1198491005 X:137141625-137141647 TTGAGAATGGATAAAGTTGATGG + Intergenic
1198593449 X:138210164-138210186 TTGTGAATGAATAAAACTGAAGG + Intergenic
1198670160 X:139071493-139071515 ATAAGAAGGAATAAAACTCTTGG - Intronic
1199099657 X:143784055-143784077 TTGTGAAAGAATAAAACTGCAGG - Intergenic
1199242466 X:145563729-145563751 TTGAGAAGGAATATAAATAAAGG + Intergenic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1199975134 X:152890317-152890339 TTGATGATGAAGAAAACTGAGGG + Intergenic
1200278731 X:154758714-154758736 TTGAGAAGCAAAAATTCTGAAGG - Intergenic
1200666074 Y:6025662-6025684 TCGAGAAGGAAAAACACAGATGG - Intergenic
1201168249 Y:11231325-11231347 TTGAGAAGGAATAAAAGGCTTGG - Intergenic
1201316617 Y:12653473-12653495 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1201345403 Y:12978293-12978315 CTGAGAAAGAACAAAGCTGATGG + Intergenic
1202063589 Y:20913943-20913965 TTCAGAAGAAATGAAAGTGATGG + Intergenic