ID: 1116632994

View in Genome Browser
Species Human (GRCh38)
Location 14:47357405-47357427
Sequence CAAATTCACTAGACAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116632988_1116632994 30 Left 1116632988 14:47357352-47357374 CCAACACTTTGGCAGCTAACACA 0: 1
1: 0
2: 3
3: 20
4: 310
Right 1116632994 14:47357405-47357427 CAAATTCACTAGACAGTGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116632994 Original CRISPR CAAATTCACTAGACAGTGTA GGG Intronic
909376220 1:74945058-74945080 CACATTCTCTAGACAATGGAGGG - Intergenic
909605544 1:77504133-77504155 CACATGCGCTAGGCAGTGTAAGG - Intronic
914007828 1:143748608-143748630 CAGAGTTACTAGACAGTGTCAGG - Intergenic
917007350 1:170429809-170429831 CAAATACACTAGAAAATCTAGGG + Intergenic
919043146 1:192418242-192418264 CAAATTACCTAGACTGTGAAGGG + Intergenic
923902885 1:238348073-238348095 CAAAGTCCCTACTCAGTGTAAGG - Intergenic
924362942 1:243260027-243260049 CAAATCCACTGAAAAGTGTAAGG - Intronic
1066150890 10:32615903-32615925 CTAATTCAATAAACAGTGTTGGG - Intronic
1066462870 10:35627302-35627324 CACAATCATAAGACAGTGTAAGG + Intergenic
1068030865 10:51703238-51703260 AAGATTCACTATAGAGTGTAAGG + Intronic
1071318663 10:84429379-84429401 CAACTTCACTATATATTGTAGGG + Intronic
1072100783 10:92227255-92227277 CTAATTCACAAGAACGTGTAAGG + Intronic
1073877699 10:107944781-107944803 CTTATTCACTAGACAGTGACTGG - Intergenic
1075140216 10:119827008-119827030 CTAACTCATTAGAGAGTGTAGGG + Exonic
1076300383 10:129421362-129421384 CAAGGCCACTAGACAGTGCAGGG + Intergenic
1081273334 11:41115399-41115421 CAAAATCACTAGAATGTCTATGG - Intronic
1084158592 11:67331056-67331078 CTATTTCAATAGTCAGTGTAAGG + Intronic
1087388031 11:97497852-97497874 CTAATTCACCAGACAGAATAAGG + Intergenic
1089145496 11:116326978-116327000 GAAATTCAGTAGAATGTGTATGG + Intergenic
1090066639 11:123509637-123509659 CACATTCCCAAGACAGTGCAAGG - Intergenic
1100430085 12:94523945-94523967 CAAAGTGACTAGACAGTCTCTGG - Intergenic
1105018830 12:132803095-132803117 AAAAAACACTAGACAGTGTTTGG + Intronic
1108321081 13:49291140-49291162 TGAATTCACTCAACAGTGTACGG - Intronic
1108562993 13:51665130-51665152 CAAATTCTCTATAGAGAGTAGGG - Intronic
1109486857 13:63035508-63035530 CAAATTCACTAAGCAGTCTTAGG + Intergenic
1112612680 13:100971117-100971139 CAAATTCACATGAAATTGTAAGG - Intergenic
1115345578 14:32339552-32339574 CAAATTCACTAAAGAGAGAAAGG - Intronic
1116632994 14:47357405-47357427 CAAATTCACTAGACAGTGTAGGG + Intronic
1117024937 14:51609526-51609548 CAAATTCACCAGGCAGAGAAGGG + Intronic
1120534239 14:85673251-85673273 CAATTTCACTACAAAATGTATGG - Intergenic
1202900847 14_GL000194v1_random:36823-36845 AATATTCACTAAACAGTGTTAGG + Intergenic
1123915733 15:25024591-25024613 CAAATACACTGCACAGTGGAAGG + Intergenic
1125039516 15:35168114-35168136 CTCACTCACTAGACAATGTAAGG + Intergenic
1125409248 15:39388021-39388043 GAAAATCACTAGAAATTGTAAGG - Intergenic
1126589786 15:50326955-50326977 CAAATTCATTTGACAATGAAGGG + Intronic
1126972519 15:54132546-54132568 ATAATTCACAAGACAGTTTAAGG + Intronic
1127536941 15:59899113-59899135 CAAATACACTGGACATTCTATGG + Intergenic
1129626007 15:77200458-77200480 AAAATTCACTACTCAATGTATGG + Intronic
1129986152 15:79921571-79921593 TAAATAAACTAGAAAGTGTATGG - Intronic
1130412266 15:83656685-83656707 CTAATTCATAAGACACTGTATGG - Intronic
1135556050 16:23437407-23437429 CAAATTCACAAGAGAATGTGAGG + Intronic
1138047942 16:53745601-53745623 CAAATAAACTAGAAAGTGTAGGG + Intronic
1146206150 17:30906966-30906988 CACATTCGCTATACAGTATATGG - Intronic
1147480049 17:40752035-40752057 CAAACTCACTAGCCACTATAGGG - Intronic
1148885824 17:50771919-50771941 CAAAATCACAAAACAGTGCAGGG - Intergenic
1149176132 17:53872779-53872801 AAAATTCATTAGGCAATGTAGGG - Intergenic
1150004319 17:61460439-61460461 CAAAGTCACTATCCAGTGAAAGG - Intronic
1155569146 18:27171069-27171091 CAAAATCACAACACAGTGTTAGG + Intronic
1157373910 18:47145233-47145255 CAAATTCACAAGACACTTTTTGG - Intronic
1157989256 18:52475266-52475288 CAAATTCAGTAGGCACTGTCAGG + Intronic
1159440515 18:68473470-68473492 CGCATTCACTAGACATTGCATGG + Intergenic
1159467027 18:68797019-68797041 GAAATTGACTAGAGAATGTATGG + Intronic
1160120234 18:76123594-76123616 GAAATTCACTGGACTGTGGAGGG + Intergenic
926465965 2:13188652-13188674 CAAATTCTATAGAAAGTGCAAGG + Intergenic
931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG + Intergenic
938708331 2:133953346-133953368 CAAATTCATTAAACACTTTATGG + Intergenic
940240347 2:151556175-151556197 AAACTTCATTAGACAGTCTATGG - Intronic
943871230 2:193003636-193003658 CAGATTCACTAGATGGTGTAGGG + Intergenic
1168864741 20:1075907-1075929 CAAAATCACAAGACAGTAGACGG + Intergenic
1170163211 20:13336912-13336934 CAAATCCAGTAGACAGAGTGTGG - Intergenic
1172770944 20:37382246-37382268 TAAATGCACAAGACACTGTAGGG - Intronic
1174178493 20:48659647-48659669 CAACCTCTCTATACAGTGTACGG + Intronic
1176620221 21:9051601-9051623 AATATTCACTAAACAGTGTTAGG + Intergenic
1176932922 21:14834451-14834473 CAAATTCACAAGACTCTGTAGGG - Intergenic
1184857148 22:47152505-47152527 CACATTCACTAGAGAGTTTCTGG + Intronic
1185017780 22:48355132-48355154 CAAATGCACCATACAATGTAAGG - Intergenic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
958496996 3:94857629-94857651 CAGATTAAACAGACAGTGTACGG - Intergenic
960307888 3:116084546-116084568 CAAAGTCACAAGACAGTTCAGGG - Intronic
960749248 3:120928202-120928224 GAAATTCACTGGAAAGTGTCAGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961264318 3:125628586-125628608 AAAATTGACTAGCCACTGTAAGG - Intergenic
962193245 3:133333164-133333186 TAAATTTAATAGCCAGTGTATGG - Intronic
970862089 4:20715955-20715977 TAATTACACAAGACAGTGTATGG - Intronic
971091173 4:23347355-23347377 TAAATTTACTAGACGATGTATGG + Intergenic
972140336 4:35951130-35951152 CAAATGCATTAGGCAGTGCAGGG + Intronic
972299582 4:37772306-37772328 CAAATTCACGATGCAGTCTAGGG - Intergenic
976099655 4:81547728-81547750 CAAATTCCAATGACAGTGTATGG - Intronic
976338304 4:83916544-83916566 CAAATTCCCTAGAAAATCTATGG + Intergenic
979229881 4:118336196-118336218 CAAATACTATATACAGTGTAAGG - Intronic
979836154 4:125370420-125370442 CTAATTCCCTACACAGTGCATGG + Intronic
983071989 4:163278593-163278615 CATACTCAATAGACAGAGTAAGG - Intergenic
984343281 4:178487102-178487124 CAAATGCACTAGACAGAGGGTGG + Intergenic
990576763 5:57130760-57130782 AAAATTCACTAAACAGTTTAAGG - Intergenic
996524691 5:124466144-124466166 CAAATTCCCTAGCCAGAGTCGGG + Intergenic
998031854 5:138877273-138877295 AAATTTCACAAGACAGTTTATGG - Intronic
998449127 5:142220815-142220837 CCAATTCACTGGGCAGTGTGGGG + Intergenic
999398436 5:151245983-151246005 TATCTTCACTAGACAGAGTAGGG - Intronic
999491346 5:152054553-152054575 CATATTCACTAGCAATTGTAAGG - Intergenic
999882593 5:155882951-155882973 GGAAGTCACTAAACAGTGTATGG - Intronic
1000420348 5:161031538-161031560 CACATTCACTAGAGTGTGGAAGG + Intergenic
1000722083 5:164720581-164720603 CCATTTCACTAGACAGTATCTGG - Intergenic
1001602349 5:172937334-172937356 CAAGTTCACTAGAAATTGGAGGG + Intronic
1005726340 6:28652393-28652415 CTTATTCACTAGACACTGAATGG - Intergenic
1007026830 6:38584711-38584733 CAACTTCCCTAGAAAATGTATGG + Intronic
1011485777 6:87840145-87840167 CAAAATATCTACACAGTGTATGG - Intergenic
1012002438 6:93669544-93669566 CAAAATCACTACTCAGTGAAAGG - Intergenic
1013451823 6:110289112-110289134 CAAAGTCACTAGGCAGAGAAGGG + Intronic
1016426804 6:143943764-143943786 CAAATTGACTAGACAGACTACGG - Intronic
1019879915 7:3849611-3849633 GAAATTCACTAGTCAGAATAAGG - Intronic
1021330285 7:19329446-19329468 CAAATTCAGAAGACAATCTATGG - Intergenic
1023623345 7:42094310-42094332 CCAATTCACTAGACAGGGTGTGG + Intronic
1024470085 7:49760039-49760061 CAAATTCACTTGATAGTTAATGG + Intergenic
1025261458 7:57421945-57421967 TAAATTTAATATACAGTGTATGG + Intergenic
1028663568 7:93313798-93313820 CAAATTCTCTTCACAGAGTAAGG - Intronic
1030422939 7:109331417-109331439 CAACTTCACTAGAAATTTTAAGG - Intergenic
1031684731 7:124719199-124719221 ATAATTAACAAGACAGTGTAAGG - Intergenic
1034789724 7:153957318-153957340 CAAATTCAGCAGACAGTCTGTGG - Intronic
1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG + Intergenic
1036457188 8:8920163-8920185 CAACTTCATTAGACATTGTGAGG + Intergenic
1041345646 8:56894763-56894785 CAAATTCTCAAAACAGTGTCTGG - Intergenic
1042523922 8:69744472-69744494 CAGCTTCTCTAGACAGTCTAGGG + Intronic
1043206663 8:77452469-77452491 CAAATGGAGAAGACAGTGTAAGG + Intergenic
1043488393 8:80721672-80721694 CAAATTGACTAGGCAGTTTTTGG + Intronic
1046570869 8:115964222-115964244 CAACTTGACTAGTCAGTGTGTGG - Intergenic
1047792275 8:128216401-128216423 GAAATTCACTGGACAATGAAAGG - Intergenic
1053153719 9:35759213-35759235 GAAATTCACTATACAGTGTGTGG - Intergenic
1057861974 9:98647914-98647936 CCATTTCAATCGACAGTGTATGG - Intronic
1061422210 9:130478543-130478565 TAAATTAACTAGAGAGTGAATGG - Intronic
1189116337 X:38346692-38346714 CAAAAATACTACACAGTGTATGG + Intronic
1194702958 X:97136828-97136850 CAAATTCAAGAGAGATTGTAAGG - Intronic
1195296038 X:103478519-103478541 CAGATTCATTAGAGAGTCTAAGG - Intergenic
1196106555 X:111902615-111902637 CACATTAACAAGACAGTGTTGGG + Intronic
1197109666 X:122757276-122757298 CAAAGTCACTTGACATTTTAAGG + Intergenic