ID: 1116635079

View in Genome Browser
Species Human (GRCh38)
Location 14:47384280-47384302
Sequence GTTGCTGCTGAGCCACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116635079 Original CRISPR GTTGCTGCTGAGCCACATGA GGG Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900993047 1:6106741-6106763 GGAGCTGCTGAGCGACATGAAGG - Exonic
901762956 1:11482400-11482422 GAGGCTGCTTAGCCACATGGTGG - Intronic
902175023 1:14642984-14643006 GCAGCTGCTGAGTCACATGGTGG - Intronic
904004458 1:27356603-27356625 GGTGCAGCTGAGCCTCTTGAGGG - Exonic
904869701 1:33608767-33608789 GTTCCTTCTGAGGCCCATGAGGG - Intronic
907634413 1:56118965-56118987 GTGGGTGCTGAGCCTCATGCAGG + Intergenic
908207834 1:61869534-61869556 CTTGCTGCTTAGTCACATAAGGG + Intronic
909913703 1:81292133-81292155 GTTGCAGATGGGCCAAATGAAGG + Intergenic
910784458 1:90980000-90980022 GTTGCTGTTGGGCCATAGGAAGG - Intronic
913380680 1:118207260-118207282 GTTGGTGGTGAGACACATGGTGG + Intergenic
914427759 1:147594080-147594102 GGTTCTGCTGAGCCCAATGAGGG - Intronic
914851199 1:151315618-151315640 GTTGCTGCTGAGACTTATGCTGG + Exonic
914992121 1:152507885-152507907 GGTGCAGCAGAGCCACTTGATGG + Intergenic
915203437 1:154251258-154251280 GTTTCTGCTGAGCCGGCTGAGGG - Exonic
916964115 1:169917723-169917745 GATGGTGCTCAGCCACATCAAGG - Intergenic
917526545 1:175793269-175793291 GGTGCTGTGGGGCCACATGAGGG + Intergenic
918927467 1:190806743-190806765 GTTGCTTCTCAGCCACACGGGGG - Intergenic
919122433 1:193358015-193358037 GTTGCTCCTGAGGCATATGAAGG - Intergenic
920108289 1:203569772-203569794 ATTGCTGCTGAGGCAGCTGAAGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920862409 1:209721384-209721406 TTTTCTGCTGAGCCATTTGAGGG - Intronic
921649220 1:217657111-217657133 ATGGCTGCTGAGCCACATTAAGG + Intronic
923853037 1:237817825-237817847 GTTGCTGCTGACCAGAATGATGG - Intronic
1063425186 10:5945273-5945295 GTGGCTGCAGAGGCACCTGAGGG - Intronic
1064313629 10:14234868-14234890 GTTGCTACTGAGTCTCATGCAGG + Intronic
1065765186 10:29022849-29022871 GCTGCTGCTGGGCCCCATTATGG - Intergenic
1065861568 10:29876734-29876756 GTTGCTGCTGCTGCACATGGTGG + Intergenic
1067190770 10:44066011-44066033 GTTGCTGTTGAGCCAGGTGTGGG - Intergenic
1067430031 10:46236758-46236780 GCTGAGGCTGAGGCACATGATGG - Intergenic
1067473619 10:46552550-46552572 GTGGCTGCTGAGCCACAGTGAGG + Intronic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1073383178 10:103097341-103097363 TTTGCTTCTGAGCCGGATGAAGG - Exonic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078863671 11:15276791-15276813 TTTTCTGATGAGCCACAAGAGGG + Intergenic
1081891735 11:46548374-46548396 GTGGCTACTGAGCGCCATGAAGG - Exonic
1083664500 11:64267214-64267236 GCTGCTGCCCAGCCACAAGACGG - Exonic
1083773972 11:64884146-64884168 GTGGCAGCTGGGCCACAGGACGG - Intronic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1085058705 11:73424886-73424908 ACTGCTGCTGAGCCACCTGGGGG + Intronic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1088849746 11:113695188-113695210 GTGGCTGGTGAGGGACATGATGG + Intronic
1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG + Intergenic
1091794429 12:3289479-3289501 GTTGCTGCTGAGCCAGCCCAGGG - Intergenic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1092761557 12:11815558-11815580 CTTCCAGCTGAGCCACCTGAAGG - Intronic
1093104133 12:15065733-15065755 GTTGCTGCTGAGGCTCAGCAGGG + Intergenic
1093582825 12:20803861-20803883 ATAGCTGCTGAGGCAAATGAAGG + Intergenic
1094841589 12:34344693-34344715 GGAGCTGCTGGGCCCCATGAGGG - Intergenic
1096292717 12:50355024-50355046 GATACTGCTGAGCCACAGAAAGG - Exonic
1096974561 12:55692762-55692784 GTACCTGTTGAGACACATGATGG - Intronic
1099230683 12:80020506-80020528 GTTGCTGCTGAACTACATCTTGG + Intergenic
1104264627 12:127219999-127220021 GATGTTGCTCAGCCACAGGACGG - Intergenic
1105941054 13:25148536-25148558 GGTGCTGAAGAGCCACATGTGGG - Intergenic
1108036655 13:46297100-46297122 GTTTCTGCTGAGTCATATGCAGG - Intergenic
1108128776 13:47274334-47274356 GTTGCTGGTGAGCTGAATGAAGG + Intergenic
1111107016 13:83659429-83659451 GTTGCTTCTGAGAAATATGATGG + Intergenic
1115247296 14:31309050-31309072 GTTGTTGCTGACCCAGATGAAGG - Exonic
1115769057 14:36651907-36651929 GTAACTGCTAAGGCACATGAGGG - Intergenic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1120520184 14:85518490-85518512 GTTGCTGCTGAATCAGAAGAAGG + Intergenic
1121728151 14:96167839-96167861 GTTGATGGTGAGGCCCATGAGGG - Intergenic
1122587599 14:102820153-102820175 GTTTCAGGTGAGCCACATGGGGG + Intronic
1122622585 14:103068347-103068369 GTTGCTGCGGAGCCAGCCGAGGG + Intergenic
1123580107 15:21707263-21707285 GGTCCTCCTGAGCCACATCATGG - Intergenic
1123616755 15:22149885-22149907 GGTCCTCCTGAGCCACATCATGG - Intergenic
1124598497 15:31111608-31111630 GATGCTCCTGAGCCCCATGTAGG + Intronic
1125120903 15:36157545-36157567 GGTGTGACTGAGCCACATGATGG + Intergenic
1125543076 15:40483113-40483135 GTCTCTGCTGAGACATATGAGGG + Intergenic
1127027284 15:54820897-54820919 GTTGAGGCTGAGTCACATCATGG - Intergenic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1130205056 15:81868180-81868202 GTTGCTGCTGATGGAGATGATGG - Intergenic
1131757335 15:95579378-95579400 TTTGATGCTGAGCGAAATGAGGG + Intergenic
1131948599 15:97655103-97655125 GATCCTGCTGAGACACATTAGGG + Intergenic
1132337530 15:101058004-101058026 GTCGGTGGTGAGCCAGATGAAGG + Exonic
1202988977 15_KI270727v1_random:441508-441530 GGTCCTCCTGAGCCACATCATGG - Intergenic
1132892724 16:2212223-2212245 GGTGCTGCAGAGCAGCATGAGGG - Exonic
1135481908 16:22827635-22827657 GTTGCTGCTGAGGTTGATGATGG + Intronic
1137581851 16:49638425-49638447 CTCGCTGCAGAGCCACATGCAGG - Exonic
1137875246 16:51990424-51990446 GGTGATGCTGACCCACATTATGG - Intergenic
1139384385 16:66555447-66555469 TTTGCTGATGAGCCAGATGTGGG + Intronic
1139613604 16:68075856-68075878 GGGGCTGCAGAGCCAAATGAGGG - Intronic
1140510896 16:75507556-75507578 GATGGTGCTGAGCCACATCTGGG - Intergenic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1142031605 16:87841296-87841318 GTACCTGCTGAGCCACATGGAGG + Intronic
1142906155 17:3043596-3043618 GATGCATCTGTGCCACATGAAGG + Intergenic
1143080068 17:4375100-4375122 GTTGCTGCTGACCCTGATGGAGG + Intergenic
1143595306 17:7910444-7910466 GGAGTTGCTGAGCGACATGAAGG + Exonic
1145013540 17:19382924-19382946 GTGGCTGATGGGCCACAGGATGG + Exonic
1146884560 17:36462447-36462469 GGTGCTGCTCAGCCCCTTGAGGG - Intergenic
1147745627 17:42692710-42692732 GTTGCTGCTTACCCACATAGAGG - Exonic
1149651794 17:58280412-58280434 GTTGGTGCTGAGCTCCATGGAGG - Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1152614830 17:81333292-81333314 GGGGCTGCTGAGCCACCCGAGGG + Intergenic
1153492016 18:5659436-5659458 CTAGGTGCTGAGCCACAAGAAGG + Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1155405119 18:25479312-25479334 GTTGCTTCTGAACCACAGGTGGG + Intergenic
1156887731 18:42155183-42155205 ATTGCTGCTGCTCAACATGATGG + Intergenic
1157045836 18:44100568-44100590 GTTGCTGCTCAGGCCCATGTGGG - Intergenic
1157929812 18:51809286-51809308 GCTGCTGCTGAGTCACAATAAGG - Intergenic
1159432531 18:68372747-68372769 GTTACTGTTGAGTTACATGAAGG + Intergenic
1164755689 19:30687299-30687321 GTTTCTCATGAGCCACATGTGGG - Intronic
931426675 2:62178060-62178082 GTAGCAGCTGGGTCACATGAAGG - Intergenic
942552021 2:177129643-177129665 GTTCCTGCCCAGCAACATGAAGG + Intergenic
944177572 2:196850070-196850092 TTTCCTGCTGAGCCACAGGGTGG + Intronic
945215880 2:207433610-207433632 GTTGGTGCTGACCCAAATGATGG + Intergenic
945471954 2:210237549-210237571 GTTCCTTCTGAGGAACATGAGGG - Intergenic
946598699 2:221335324-221335346 GTTGCTGCTGACCCTGCTGATGG - Intergenic
947837221 2:233184526-233184548 GTGGCTGCTGAGCCACCTTCTGG + Intronic
1169450872 20:5709830-5709852 CTTGCAGCTCAGCCACATGAGGG - Intergenic
1169844727 20:9977315-9977337 GTTGCTGATGAGCTACACGAAGG - Intergenic
1170159279 20:13295952-13295974 GTTGCTCCTGAGCCATGTCAGGG - Intronic
1170584218 20:17722146-17722168 GTTGCTGGAGAGCCCCAGGAGGG + Intronic
1170849866 20:19995062-19995084 GTGGCTCCTGATCCACATGGAGG + Intronic
1171202594 20:23254301-23254323 GGTGCTGCAGAACCCCATGAAGG + Intergenic
1173836645 20:46130376-46130398 TTTCCTGCTGAGCCAACTGAGGG + Intergenic
1174396473 20:50250067-50250089 GGTGCCGCTGAGTCACATGGAGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179275251 21:39885932-39885954 GTTCCTTCTGAGCACCATGAGGG + Intronic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1181465686 22:23109472-23109494 GTGGGTGCTGAGCCAAGTGAGGG + Intronic
1182295760 22:29310637-29310659 GGTGCTGAGGAGCCACGTGATGG + Exonic
1184959072 22:47915738-47915760 GTTTCTCCTGAGCCACAGCATGG - Intergenic
1185247640 22:49781535-49781557 GTGGCTGCCGAGACACCTGAGGG + Intronic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
952386522 3:32845410-32845432 GGAGCTGCTCAGCCAGATGAGGG - Intronic
954983789 3:54771237-54771259 GGTGATGCTGACCCACATAATGG - Intronic
956437604 3:69248733-69248755 GTTGCTGCGGAGACACTTAATGG - Intronic
956704013 3:71983704-71983726 GTTGCTGCTGAGACACCAGGTGG + Intergenic
957322501 3:78650397-78650419 ATTGCTGCTGAGCCACAGGCAGG + Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
962152922 3:132911957-132911979 GTTGCAGCTGAGTCATATAATGG + Intergenic
963667536 3:148207877-148207899 GTTGCTGCAGATCCATATGGAGG - Intergenic
964436492 3:156658925-156658947 GTTTCTCCTGAGCCAGATGTGGG - Intergenic
966326008 3:178755152-178755174 GTTGCTGCTGCCCCAGATGGAGG - Intronic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
971645235 4:29190980-29191002 GTTGCTTCTGAGGGTCATGAGGG + Intergenic
977396076 4:96472428-96472450 GTTGCAGCTGTGACTCATGATGG - Intergenic
977408385 4:96630340-96630362 GTCTCTGCTGAGGCATATGATGG + Intergenic
978904619 4:113991164-113991186 GCTGCTGCTGAAGCACAGGAAGG + Intergenic
979832782 4:125321062-125321084 ATGGCTGCTGACCCAGATGAAGG + Exonic
981069777 4:140523083-140523105 GTTGCTTCTGAGCAAGGTGACGG + Intergenic
981307182 4:143259259-143259281 GTTGCTTCATAGCCACAAGATGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985706702 5:1405731-1405753 GATGCTGCTGAGCCAGAGGGAGG + Intronic
987436899 5:17905901-17905923 GTGGCTGCTGTGGCATATGAGGG + Intergenic
990417095 5:55597099-55597121 TTTGTTGCTGAGCCACATGGTGG + Intergenic
992106620 5:73453357-73453379 GTTGCTACTAAGCCTCATGGAGG + Intergenic
993157871 5:84250056-84250078 TTTGCGGCTTAGCCACATGGTGG + Intronic
993193802 5:84713798-84713820 GTTGCTTCTAAACAACATGAAGG + Intergenic
995048084 5:107672009-107672031 GTTGCTGCTGTGCCTAAGGAGGG - Intergenic
998722000 5:144963154-144963176 GTTGCTGGTAAGTCACATAAGGG - Intergenic
999132676 5:149296477-149296499 GTGGCTGCAGGGCCACAGGAGGG + Intronic
1000199051 5:158989355-158989377 GCTGCTCCTGAGCCAAATGATGG + Intronic
1001132368 5:169074859-169074881 GTGGCTCCAGAGCCACCTGAGGG + Intronic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1005061107 6:21777823-21777845 CTTCCTACAGAGCCACATGACGG - Intergenic
1008535268 6:52502592-52502614 GTGGCTGCTGTGCCTCAAGATGG + Exonic
1011179285 6:84601531-84601553 CTTCCTGCAGAGCCACATGGCGG - Intergenic
1013073507 6:106750648-106750670 GGTGGTGCTGAGCCACACGGAGG - Intergenic
1017051787 6:150400129-150400151 GCTGCCCCTGAGCCACAGGAGGG - Exonic
1017787470 6:157768370-157768392 GGTGCTGCTGAGCCCCAGGGTGG - Intronic
1018576990 6:165269151-165269173 GCTGCTGCTTAGCAACAGGAAGG + Intergenic
1021629999 7:22635453-22635475 GTACCTGCTGAGACACATCAGGG - Intergenic
1023668738 7:42554191-42554213 TTTGCATGTGAGCCACATGAAGG - Intergenic
1024125998 7:46295105-46295127 GTTCCTGTTGTGCCACCTGAGGG - Intergenic
1024922613 7:54575313-54575335 GTTGCTGCTGGTCCTCATGTGGG + Intergenic
1026364053 7:69629705-69629727 GTAGCCTGTGAGCCACATGAGGG + Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1030766130 7:113411866-113411888 CTTGTTGCTGAGTCTCATGAGGG - Intergenic
1031673007 7:124574822-124574844 GTTGCTCCAGACCCACACGATGG + Intergenic
1032642405 7:133784522-133784544 GTTGCTGGTGAGCTCCATCAGGG + Intronic
1034677031 7:152899225-152899247 GGTGCTGCTCAGACACCTGAAGG - Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1041030135 8:53728299-53728321 GTGGCTACTGAGCCCCAGGAAGG + Intronic
1047931541 8:129733010-129733032 GGACCTGCTGAGCCACATGCGGG - Intergenic
1048081009 8:131127066-131127088 GTTGCTGATTAAACACATGAGGG + Intergenic
1049016379 8:139922981-139923003 GTTTCTGATGAGCCTGATGAGGG - Intronic
1050134877 9:2452120-2452142 GATGCTCCTGTGCCCCATGAAGG + Intergenic
1052213498 9:25936116-25936138 TTTGCTGCTAAGCCTCATGGAGG - Intergenic
1056102935 9:83317281-83317303 GTTGCTGCTTAGTGACATGCTGG - Intronic
1058590158 9:106556936-106556958 GTTTCTGCTGAGGGCCATGAGGG - Intergenic
1058701558 9:107604907-107604929 GTTCTTGCTGACCAACATGATGG - Intergenic
1062347309 9:136120939-136120961 GGTGATGCTGACCCACATGGAGG - Intergenic
1062609656 9:137368295-137368317 ATTGCTGATGAGCCAGAGGAAGG + Intronic
1188989480 X:36800385-36800407 GTTGCTATTGAGGTACATGAAGG - Intergenic
1194505027 X:94723831-94723853 GTGGCTGCTGTGGGACATGAGGG + Intergenic
1195364771 X:104115303-104115325 GATGCTTCTGAGCCACAGTAAGG + Exonic
1195947298 X:110228861-110228883 TTAGCTGCTGAGCTACATAAAGG + Intronic
1197177890 X:123504274-123504296 GTATCTGCTGACTCACATGATGG + Intergenic
1200951219 Y:8901908-8901930 AGTCCTGCTGAGCTACATGATGG - Intergenic
1202161612 Y:21940828-21940850 AGTCCTGCTGAGCTACATGATGG + Intergenic
1202229744 Y:22645545-22645567 AGTCCTGCTGAGCTACATGATGG - Intergenic
1202313412 Y:23550620-23550642 AGTCCTGCTGAGCTACATGATGG + Intergenic
1202557391 Y:26119975-26119997 AGTCCTGCTGAGCTACATGATGG - Intergenic