ID: 1116635160

View in Genome Browser
Species Human (GRCh38)
Location 14:47385244-47385266
Sequence ACTATGACACTGATCGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116635160 Original CRISPR ACTATGACACTGATCGTTTC TGG Intronic
910214054 1:84824368-84824390 ACCATGACACTATTTGTTTCTGG + Intronic
912742036 1:112207229-112207251 ACTTGGAAACTGATCCTTTCAGG - Intergenic
917932111 1:179829678-179829700 ACCAAGAGAATGATCGTTTCCGG - Intergenic
920872569 1:209806239-209806261 AATATGACACTCCGCGTTTCTGG + Intergenic
1063517229 10:6709061-6709083 ACTATGACAGTGTTAATTTCTGG + Intergenic
1067766953 10:49094114-49094136 ACTATGACATTGTTACTTTCCGG + Intronic
1075260800 10:120962557-120962579 ACTAAGCCACTCATCCTTTCTGG + Intergenic
1090957284 11:131524788-131524810 ACTATGACACTGATCAGTGGCGG + Intronic
1094027807 12:25977154-25977176 ATTATGACCCTGTTTGTTTCAGG + Intronic
1094030611 12:26007643-26007665 ACTATGCCCCTGTTCCTTTCTGG - Intronic
1094261936 12:28510467-28510489 TGTCTGACACTGATCTTTTCTGG - Intronic
1100141488 12:91624128-91624150 TCGATAACACTGATCATTTCAGG + Intergenic
1107098347 13:36560711-36560733 ACTGGGACACAGATGGTTTCCGG + Intergenic
1108548407 13:51519478-51519500 GATGTGACACTGATGGTTTCAGG + Intergenic
1116635160 14:47385244-47385266 ACTATGACACTGATCGTTTCTGG + Intronic
1128018448 15:64368833-64368855 ACTATAACACTGATCATCACAGG - Intronic
1129886791 15:79043791-79043813 ACTATGACTGTGATGCTTTCAGG - Intronic
1148536826 17:48446040-48446062 ACTATGGCAGTGTTCATTTCTGG + Intergenic
1151546335 17:74795571-74795593 ACAATGACACTGACCGGTGCTGG + Exonic
1156777987 18:40817079-40817101 TATATGACACTGTTTGTTTCTGG + Intergenic
1156935140 18:42695551-42695573 ACTCTGAAATTGATTGTTTCTGG + Intergenic
926122040 2:10246656-10246678 ACTACCACACTGATGGATTCTGG + Intergenic
926662906 2:15488064-15488086 ATTATGACATTGATCCATTCAGG + Intronic
942907543 2:181201961-181201983 ACTATTACCCTGATGTTTTCTGG - Intergenic
943183729 2:184577730-184577752 ACTAAGACAATCATTGTTTCAGG - Intergenic
944948200 2:204715512-204715534 ACTATGCAACTGAGTGTTTCTGG + Intronic
1168863235 20:1061328-1061350 ACTGTGACACAGATGCTTTCTGG + Intergenic
1169349846 20:4859402-4859424 GCTGTGGCACTGATCGTTTATGG - Intronic
1178052526 21:28763739-28763761 ACTATGACCATGTTCTTTTCAGG + Intergenic
1181151682 22:20888392-20888414 ATTCTAACACTGATCCTTTCTGG - Exonic
1182956873 22:34434888-34434910 GCTATGACAGTCATGGTTTCTGG - Intergenic
951893782 3:27591427-27591449 ACTATGACACACATGGTTCCAGG + Intergenic
953205489 3:40824056-40824078 GCTATCACAGTGATCGTTTCTGG + Intergenic
960280447 3:115775452-115775474 ACTATGACAGTGTCCTTTTCAGG + Intergenic
975069836 4:70120243-70120265 ACTATGACAGTAATGGTTTTGGG - Intergenic
978708968 4:111753785-111753807 ACTATGTTACAGATTGTTTCAGG - Intergenic
984208900 4:176821734-176821756 ACTGTGACACTGATGTATTCGGG - Intergenic
986739284 5:10692021-10692043 ACTCAGTCACTGAGCGTTTCTGG - Intronic
990546263 5:56824905-56824927 ACTAATATACTGATCTTTTCCGG + Intronic
996640419 5:125744727-125744749 ATTATGACATTAATCGATTCTGG - Intergenic
1000138380 5:158377160-158377182 ACTATAACAATGATTGTCTCTGG + Intergenic
1000725636 5:164767259-164767281 ACAATGACAATGATCGTTGAGGG - Intergenic
1001367552 5:171159250-171159272 ACTCTGAAACTGATCATTCCTGG - Intronic
1002213672 5:177612934-177612956 TCTATGACACAGATCCTTTGGGG + Intergenic
1003794336 6:9583089-9583111 ACTTTGACACAGAACGTTTCTGG - Intergenic
1005282763 6:24292047-24292069 ACTGTGAAACTGCTCGATTCTGG - Intronic
1024244938 7:47462254-47462276 GCTGTGACAATGATCGTTACTGG - Intronic
1031439957 7:121781992-121782014 ACTATGCTTCTGATCTTTTCTGG + Intergenic
1033363320 7:140653217-140653239 ACTAAGACAAGGATTGTTTCTGG + Intronic
1033945732 7:146715469-146715491 ACTATGATATTCATCTTTTCAGG + Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1036609232 8:10335125-10335147 ACATTGACCCTGACCGTTTCTGG - Intronic
1038166035 8:25085881-25085903 CCTATGACACTGACCTTCTCTGG - Intergenic
1043563725 8:81524412-81524434 ACTATCACTCAGATGGTTTCAGG - Intergenic
1050930606 9:11319389-11319411 AATATGACACTGTGCCTTTCTGG - Intergenic
1051254123 9:15194760-15194782 ACTATTACAGTAATTGTTTCAGG + Intronic
1051415083 9:16831076-16831098 ACCTTGACACTGATTGTTTTAGG - Intronic
1058057526 9:100464006-100464028 ACTATGACAGTGCTCTTTCCTGG + Intronic
1186752768 X:12638838-12638860 ACTATGACTCTGATGCTATCTGG - Intronic
1188152538 X:26696323-26696345 ACCATCACACTGATCTTTTTTGG + Intergenic
1195411675 X:104573134-104573156 ACTATGTAAATGATAGTTTCAGG + Intronic
1196551813 X:117037337-117037359 ACTATGTAAAAGATCGTTTCTGG - Intergenic
1200323571 X:155215336-155215358 ACCATGACTCTGACCTTTTCTGG - Intronic