ID: 1116635507

View in Genome Browser
Species Human (GRCh38)
Location 14:47389727-47389749
Sequence CAGGGTGAAAAAAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 584}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116635496_1116635507 0 Left 1116635496 14:47389704-47389726 CCTACTTTGCAGTCCTTGGGCCT 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG 0: 1
1: 0
2: 3
3: 46
4: 584
1116635492_1116635507 4 Left 1116635492 14:47389700-47389722 CCGCCCTACTTTGCAGTCCTTGG 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG 0: 1
1: 0
2: 3
3: 46
4: 584
1116635495_1116635507 1 Left 1116635495 14:47389703-47389725 CCCTACTTTGCAGTCCTTGGGCC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG 0: 1
1: 0
2: 3
3: 46
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116635507 Original CRISPR CAGGGTGAAAAAAGGGGGGA GGG Intronic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
901333656 1:8429984-8430006 TAGGGTGAAAAAAGGGAACATGG + Intronic
901901708 1:12369564-12369586 CAGAGTGATAAAAGGTGGCAAGG - Exonic
903271291 1:22190063-22190085 AAGGGTGCAAAAAGGGGGTGTGG + Intergenic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904594122 1:31632331-31632353 CTGGGTCAAAGAAGGGGTGAGGG + Intronic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
906335353 1:44925500-44925522 CGGGGAGAAAAAAATGGGGAGGG + Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907392781 1:54169104-54169126 GAGGGAGAAAGAAGGGGGAACGG + Intronic
907659692 1:56380623-56380645 CAGGAGGAAAATAGGGGAGAAGG + Intergenic
909570347 1:77102963-77102985 GAGGGTGAAAGAAAGAGGGAAGG + Intronic
910491145 1:87773039-87773061 AAGGGAGAAAAAAGGGGAGAAGG + Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
910860100 1:91734588-91734610 CAGGAGGAAAAAAGAAGGGAGGG + Intronic
911449811 1:98048597-98048619 GAGGGTGGAGAAGGGGGGGAGGG - Intergenic
911645067 1:100328964-100328986 CAGGGAGAAAGAAAGAGGGAGGG - Intergenic
912902081 1:113662194-113662216 AAGGGGGAAAAAAGGATGGAGGG - Intronic
913513098 1:119580521-119580543 CAGGCTGAAAAACCAGGGGAAGG - Intergenic
913938999 1:125085838-125085860 CGGGGTGCAAAAAGTGGCGAGGG + Intergenic
914878077 1:151526942-151526964 CAAGGTGAAATAAAGGGGAAAGG - Intronic
915306736 1:154984073-154984095 CTGGGACAGAAAAGGGGGGAGGG + Intronic
916106234 1:161434676-161434698 CAGGGTGATAATAAGGGGAAAGG - Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917327650 1:173849829-173849851 CATAATGAAAAAAAGGGGGAGGG - Intronic
917547721 1:175989102-175989124 GAGGATGAGATAAGGGGGGAGGG + Intronic
917672114 1:177282711-177282733 CAGGGAGAAAAAAAAGGTGATGG - Intergenic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
919111339 1:193222789-193222811 AGGTGAGAAAAAAGGGGGGATGG - Intronic
919128019 1:193419907-193419929 CAGGGTGAAAAAACAAGGGTGGG + Intergenic
919210673 1:194479964-194479986 AAGGAGGAAATAAGGGGGGAGGG - Intergenic
919640279 1:200039450-200039472 CAGGGTTAAAAAAGGAGGCGAGG - Intronic
919675067 1:200373890-200373912 CAGGCAGAAAAAAAGGGGGGAGG + Intergenic
920567198 1:206983652-206983674 GAGGGGGAAAAAAGGGGCAAAGG - Intergenic
921016707 1:211198411-211198433 TAGGGTCCAAAAAGGGCGGAAGG - Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922453082 1:225752277-225752299 CAGGGGGAAGAAAATGGGGAGGG - Intergenic
923286739 1:232503338-232503360 CAGGGAAAAAAAATGGGGGCAGG + Intronic
923393866 1:233541483-233541505 GAGGGAGGAAAAAGTGGGGATGG + Intergenic
923486897 1:234441705-234441727 CAGGGAGAAAATAGGGGTTAAGG - Intronic
923965650 1:239135615-239135637 CAGGGAGCAAAAATGAGGGATGG - Intergenic
924097065 1:240563748-240563770 GTGGGTGAAAAATGGGGAGATGG - Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
924743797 1:246814055-246814077 CATGGGGAAGAACGGGGGGAAGG - Intergenic
924918246 1:248596945-248596967 CAAGGGGAAAAAAGGAGGAAAGG + Intergenic
1064949182 10:20827922-20827944 GAGGGTGAAGAAGGAGGGGAGGG + Intronic
1065027126 10:21549600-21549622 CAGGCAGAAAGAAGGGGAGAGGG + Intronic
1065308395 10:24390447-24390469 ATGGGGGAAAAAAGGAGGGAGGG + Intronic
1065929104 10:30463398-30463420 CAGAGTGAAATAATGGGGGAGGG - Intergenic
1066334847 10:34465315-34465337 CAGGGAAAAAAAAGGGGGTTGGG + Intronic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067905336 10:50284960-50284982 CAGGGTGAGGAAAGTTGGGAAGG - Intergenic
1068359379 10:55955329-55955351 CAGGAAAAAAAAAGGGGGGGCGG + Intergenic
1068406605 10:56598211-56598233 CAGAAAGAAAAAAGGGGGGCGGG - Intergenic
1068941679 10:62686890-62686912 CAGGGAGAAAAAAAGAGGCAAGG + Intergenic
1070144799 10:73765988-73766010 AAGGGACAAAAAAGGGGTGAGGG - Intronic
1070363314 10:75712237-75712259 GAGGGAGAAACAAGGGGGGCGGG - Intronic
1070430938 10:76336940-76336962 CAGATTAAAAAAAGGGGGGTGGG - Intronic
1070579801 10:77710824-77710846 CAGGGCTTAAAAAGGGGGGTGGG - Intergenic
1071495016 10:86162226-86162248 CAGGGAGGAAAAAGGGAAGAGGG + Intronic
1073101470 10:101008876-101008898 CAGGGTGACATGAGGAGGGAGGG - Intronic
1073155112 10:101340280-101340302 AAGGGTGAAAGAAGTGGGTAAGG + Intergenic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073378736 10:103060773-103060795 AAGGTTGAAAACAGGGTGGAAGG + Intronic
1073759234 10:106612372-106612394 GAGGGGGAGAAAAGGGGGAAAGG - Intronic
1075510564 10:123069270-123069292 GAAGGAGATAAAAGGGGGGAGGG + Intergenic
1075846279 10:125547259-125547281 CAGGAGGAAAAAAGGGTGGCTGG + Intergenic
1076019204 10:127056598-127056620 AAGAGAGAAAAAAGGAGGGAAGG - Intronic
1077030092 11:461633-461655 CAGGCTCAGAAAAAGGGGGAAGG - Intronic
1077733845 11:4766720-4766742 AAGGATGAAAAAAGGAAGGAAGG - Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078563421 11:12392851-12392873 CAGGGTTAAAAAATGAGTGAAGG - Intronic
1078619881 11:12897451-12897473 CAGGTTGAATGAAGGGGAGAGGG + Intronic
1079739843 11:24044107-24044129 AGGGGTGAAAAAAAGGGTGATGG - Intergenic
1079964382 11:26963149-26963171 GAGGGAGAAAAAAGAGAGGAAGG + Intergenic
1080036842 11:27719737-27719759 CGGGGTGGAAGAAGGGGGGCGGG + Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080925945 11:36755926-36755948 CAGGGTGAATAAGGTGAGGATGG + Intergenic
1082093677 11:48109658-48109680 CAGGGCCAAAAAAAGGGGGTTGG - Intronic
1082762724 11:57143094-57143116 CATGGTAAAACTAGGGGGGAAGG + Intergenic
1083213430 11:61203688-61203710 GAGGGAGAAAAAAGGGAAGAAGG - Intronic
1083224663 11:61277156-61277178 AAGAGAGAAAAAAGGAGGGAGGG + Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084373649 11:68761688-68761710 CTGAGTGACAAAAGGTGGGAAGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085792499 11:79508075-79508097 CAAGGTGAAAAAAAGTGGGATGG + Intergenic
1085849515 11:80103424-80103446 AAGGGGGAAAAAAGGAAGGAGGG - Intergenic
1085903283 11:80728161-80728183 CAGGGAGAAAGAAGGGACGATGG + Intergenic
1086423883 11:86665024-86665046 CAGGGTGAAAGAAGGGGCCTTGG + Intronic
1086467268 11:87067918-87067940 CAGATTAAAAAAAGGGGGGGCGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1086841642 11:91692713-91692735 CACTGAGGAAAAAGGGGGGAAGG + Intergenic
1086955662 11:92932479-92932501 GAGGGAGAAAGAAGGGAGGAAGG - Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088119945 11:106356709-106356731 GTGGGGGAAAAAAGGAGGGAGGG - Intergenic
1088735615 11:112725480-112725502 CAGGGAGCAACATGGGGGGAGGG + Intergenic
1089271579 11:117305261-117305283 AAGGCTGAGAAAAGGGGGCAAGG + Intronic
1089402914 11:118174887-118174909 CAGGCTGAAAGAAGGGGAGTTGG - Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1090880858 11:130830519-130830541 AAGGGTGCAAAAAAGGGGGCAGG - Intergenic
1090973259 11:131660634-131660656 CAGGAAGGAATAAGGGGGGAGGG - Intronic
1091060028 11:132452513-132452535 CAGGCTGAAAGAAGGAAGGAAGG - Intronic
1091765138 12:3115076-3115098 CAGGGAGAAAAACTGGGGGCAGG - Intronic
1091934794 12:4426573-4426595 CCGGGTGAAAGCAGGGAGGAGGG + Intergenic
1092233069 12:6788537-6788559 CAGTCTGAAAAAAGTGGGGCTGG - Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092246344 12:6866465-6866487 CAGGGGCAAACAAAGGGGGAGGG - Exonic
1092256294 12:6928198-6928220 CAGGCGGGGAAAAGGGGGGATGG + Intronic
1093005593 12:14047481-14047503 AAAGGTGAATAATGGGGGGAGGG + Intergenic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093660814 12:21754370-21754392 CAAGGTGAGAGAAGGGGAGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094244856 12:28277668-28277690 CAAAGTGAAAAAAAGGAGGAGGG - Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095569290 12:43664781-43664803 CAAGTGGAAAAAAGGAGGGAAGG - Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096224312 12:49855396-49855418 AAGGATGAAAAAAGGAGGGAAGG - Intergenic
1096994623 12:55830872-55830894 CAGGGTGGAGAAAGGGGACAGGG - Intergenic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1098092858 12:66922728-66922750 CAGAGGGAGAAAAGGGGGAAGGG - Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098870761 12:75814491-75814513 CAGGGTGAAAATACTGGGGTAGG + Intergenic
1100391787 12:94150243-94150265 GAGAGTGTAAAAAGGGGGGCGGG + Intronic
1100609649 12:96180744-96180766 CAGAATGAAAAATGGGGGGTGGG + Intergenic
1100629363 12:96371955-96371977 CATGTTAAAAAGAGGGGGGACGG + Intronic
1100783582 12:98055431-98055453 CAGGGAGAAAAATGGAGAGAAGG + Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101564612 12:105893914-105893936 GAGGGAGGAAAAAGGGGGGGGGG + Intergenic
1102227308 12:111237836-111237858 CAGGGGGAGAAACGGGGGCAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102745232 12:115243968-115243990 GAGGGAGAAAAAGGGAGGGAGGG + Intergenic
1102976648 12:117211571-117211593 GAGGGTGAGAAAAGGTGGGCTGG - Exonic
1103074063 12:117968293-117968315 CAGAGAGAAAAAAGAGGGGGGGG + Intronic
1103244695 12:119446586-119446608 CAGGAAGAAAAAAAGGGAGAGGG + Intronic
1103442059 12:120970518-120970540 CAGGCTGACAAAAGTGGGCAGGG + Intergenic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1103468763 12:121162965-121162987 GAGGGTAAAAGAGGGGGGGAAGG + Intronic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1105253846 13:18726537-18726559 GAAGGTGGAAAAAAGGGGGATGG + Intergenic
1105412694 13:20184641-20184663 CAGGGCGAGAAAGGGGGAGATGG - Intergenic
1105587277 13:21756858-21756880 CAGGGTGAAGTCAGGGGGCAGGG - Intergenic
1106042860 13:26110361-26110383 CGGGGTGGGGAAAGGGGGGAGGG + Intergenic
1106276939 13:28218632-28218654 AAAGGGGAAAAAAGAGGGGAAGG - Intronic
1106931209 13:34667805-34667827 CAGGGTGAAAAAAGCAGGAGTGG + Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1108162509 13:47656588-47656610 CATGGGGGAAAAAGAGGGGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1109903232 13:68802265-68802287 CATGCTGAAAACAGGGGCGAGGG - Intergenic
1110783238 13:79491110-79491132 CAGGGAGAAAGAAGGGAGGTAGG - Intronic
1111844129 13:93488110-93488132 TGGGGTGAAAGGAGGGGGGAGGG - Intronic
1113454405 13:110437999-110438021 CAGGGTGAAAAAGGCAGTGAGGG + Exonic
1114290671 14:21285868-21285890 CAGGCAGAAATAAGGGAGGATGG + Intergenic
1115279167 14:31641316-31641338 AGGGATGAAAAAAGGGGGTAAGG - Intronic
1115666318 14:35552798-35552820 CAAAAGGAAAAAAGGGGGGAAGG + Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117047570 14:51828461-51828483 CAGGAGGAAAAAAGGAGGGAAGG + Intronic
1117440706 14:55756564-55756586 CAGGGAGAAAAGAGGTGGGTTGG + Intergenic
1117543572 14:56771758-56771780 CAAGGCAGAAAAAGGGGGGAGGG + Intergenic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118110337 14:62711482-62711504 CCGGGCGTAAAAAGGGGGAAAGG - Intronic
1118535459 14:66758578-66758600 CAAAATGAAAAAAGGGGGTAAGG + Intronic
1118868988 14:69726122-69726144 CAAGGAGAAGAAAGGCGGGAAGG + Intergenic
1119892738 14:78195064-78195086 CAGGGAAAAAAAAGGGTGGGGGG - Intergenic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120288854 14:82540971-82540993 AAGGAGGAAAAAAGGTGGGAAGG - Intergenic
1120641168 14:87014922-87014944 CAAGGTGAAAGATGAGGGGATGG - Intergenic
1121254048 14:92518626-92518648 CAGGGAGAAAGGATGGGGGAAGG + Intronic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121657092 14:95605080-95605102 AAGGGAGAAAAAAAGGGGCAGGG - Intergenic
1121888828 14:97570518-97570540 CAGGATGAGAAAAGGGGAGAAGG + Intergenic
1122398896 14:101455498-101455520 CAGGTGGAAAGAAGGGTGGAAGG + Intergenic
1122415211 14:101546264-101546286 CAGGGAGAAGAAGCGGGGGAAGG + Intergenic
1123009485 14:105340854-105340876 CAGGGTGAAAGGAGTGGGCAGGG + Intronic
1125156977 15:36598707-36598729 GAGGGTGGAAAAGGGAGGGACGG - Intronic
1125200892 15:37100080-37100102 CAAAGCTAAAAAAGGGGGGAGGG - Intronic
1125635872 15:41188300-41188322 GAGGGAGGAAAAAGAGGGGAGGG - Intronic
1126412068 15:48382377-48382399 CAGGTTGAAGAAATGGGGAATGG + Intergenic
1126598525 15:50405606-50405628 AAGGGAGAAAAAAAGAGGGAAGG + Intergenic
1126983702 15:54277394-54277416 CAGGGTGAAAAAAGATGATATGG - Intronic
1127158956 15:56160076-56160098 CAAGGTTAAAAAAGTGGGGAAGG + Intronic
1127446352 15:59067188-59067210 CAGGGAGAGAAATGGAGGGAGGG - Intronic
1127660795 15:61098245-61098267 GAGGGAGAAAAAAAGGGGGGAGG - Intronic
1128538035 15:68505163-68505185 TGGGGTCAAAAAAGGGGGCAGGG + Intergenic
1129192018 15:73942821-73942843 CAGTGGGAGAGAAGGGGGGAGGG - Intronic
1130029362 15:80297741-80297763 GAGGATGAGAAAAGAGGGGAAGG + Intergenic
1130858138 15:87860204-87860226 GAGGGTGAAGAATGGGGTGATGG + Intronic
1131632322 15:94191494-94191516 GAGGGAGACAAAAGGAGGGAGGG + Intergenic
1131805179 15:96114774-96114796 CAGGGGGAGAAAAGTGGGGAAGG - Intergenic
1132054054 15:98635736-98635758 CAGGCTCAAAAAAAGGGGAAAGG + Intergenic
1133363898 16:5195961-5195983 CAGGATGAAACAAGGGTGGGTGG + Intergenic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1134268962 16:12717042-12717064 CAGGGGGAAAGAAGGTGGGGAGG + Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135341581 16:21653128-21653150 CCCTGTCAAAAAAGGGGGGAAGG - Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135732513 16:24906842-24906864 CAGGGTCAAGAAAGGAGGGCTGG + Intronic
1136070016 16:27782093-27782115 CAGGGAGGAAAAAGGAGAGAGGG + Intergenic
1136253765 16:29024633-29024655 CAGGGGGAAAGAAGGTGGGGTGG + Intergenic
1136567659 16:31079819-31079841 CAGGGTGAAAGAAGAGGTGTGGG + Exonic
1137408417 16:48207919-48207941 CAGGGAGAAAGAAGGAAGGAAGG - Intronic
1137662334 16:50219674-50219696 GAGGGAGAAGAAAAGGGGGAGGG - Intronic
1137739566 16:50754623-50754645 CAGGGGGAAAGAATGGGGGGTGG - Intronic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138803228 16:60060561-60060583 AAGGGGGAAAAAAGAAGGGAAGG + Intergenic
1140036752 16:71377069-71377091 CAGGAGCAAAAAAGGGGGTAAGG + Intronic
1140396864 16:74634804-74634826 GAGGAAAAAAAAAGGGGGGAAGG + Intronic
1140598320 16:76442564-76442586 CAGGGTCAAAACAGTGGAGAAGG + Intronic
1140862176 16:79027432-79027454 CAGGGTGTAAAATGGGAGGCAGG - Intronic
1140976475 16:80064508-80064530 CCCATTGAAAAAAGGGGGGAAGG - Intergenic
1141793068 16:86249768-86249790 GAGGGTGGAAAATGGAGGGATGG - Intergenic
1141842096 16:86579706-86579728 CAGGGGGAAATAAGAGAGGAAGG - Exonic
1141970836 16:87481514-87481536 CAGGGAGAGAAACGGGGGGGGGG + Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142698618 17:1646691-1646713 GATGGTGAGAAAAGGGGAGAGGG + Intronic
1143628148 17:8122491-8122513 CAGGGGGAAGAAGGGAGGGACGG + Intronic
1143715852 17:8768538-8768560 AAGGGAGAAAAATGGGGGGGGGG - Intergenic
1143905803 17:10208167-10208189 CAATGTTTAAAAAGGGGGGAAGG + Intergenic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144550060 17:16232692-16232714 TAGGGAGAAAAAATGGGAGAGGG + Intronic
1145228694 17:21153729-21153751 ATGGGTGAAAAAAAGGGGGAAGG + Intronic
1145327464 17:21843442-21843464 CGGGGTGCAAAAAGGGGCGGGGG - Intergenic
1145878937 17:28340162-28340184 CAGGGTGACAGAGGCGGGGATGG - Intronic
1146247138 17:31296590-31296612 TATGGTTAGAAAAGGGGGGAGGG - Intronic
1146809335 17:35890752-35890774 CAAGGTGACAGAAGAGGGGAGGG - Intergenic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147363358 17:39944850-39944872 TAGGGGGAATAAAGGAGGGAGGG - Intergenic
1147684211 17:42276982-42277004 CAGGGTGAACCTACGGGGGACGG + Intergenic
1148534624 17:48429538-48429560 CAGGGTGATAAAGGGAGGGCTGG + Intronic
1148605757 17:48927789-48927811 AAGGGTGAGGAAAGAGGGGAGGG - Exonic
1148719152 17:49738415-49738437 AAAGGGGAAAAAAGGAGGGAGGG + Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149422164 17:56521481-56521503 CAGGGTGAGAGCAGGGGGGTGGG + Intergenic
1149591318 17:57831846-57831868 CAGGGTAAAATAAAGTGGGAGGG + Intergenic
1150067995 17:62127650-62127672 CCGGCAGAAAAAAAGGGGGAAGG - Intergenic
1150082684 17:62254313-62254335 CAGGGAAAAAAAAGGGGTGGGGG + Intergenic
1151065738 17:71147805-71147827 CAGAGAGGAAAAAGGGAGGAGGG - Intergenic
1151113496 17:71706217-71706239 CGGGGTGGGAGAAGGGGGGAGGG - Intergenic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151952703 17:77363977-77363999 CAGGGGGAGAAAAGTGAGGAGGG + Intronic
1152367086 17:79862536-79862558 CAGGCTTAAAGACGGGGGGAGGG + Intergenic
1152816195 17:82409328-82409350 ACGGGTAAAAAAAGGGGGGCAGG + Intronic
1153180947 18:2432315-2432337 CAGGGTGGAGAATGGTGGGAAGG + Intergenic
1155266169 18:24095945-24095967 GAGGGAGAAAGAAGGGGGAATGG + Intronic
1155455451 18:26007406-26007428 AATGGAGAAAAAAGTGGGGAAGG - Intergenic
1155731267 18:29161451-29161473 CAGGGTGGAAAATGTGGGCAAGG + Intergenic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1156792515 18:40992810-40992832 CATGAAGGAAAAAGGGGGGAGGG - Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157772596 18:50362478-50362500 GAGGATAAAATAAGGGGGGAAGG - Intergenic
1158968248 18:62642571-62642593 CAGGAGGAAAATAAGGGGGAAGG - Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159393523 18:67827025-67827047 AAAGGAGAAAAAAGGAGGGAAGG - Intergenic
1159550745 18:69894094-69894116 CAGAGTGAAAGAAGGAAGGAAGG + Intronic
1159848511 18:73496138-73496160 CAGATTAAAAAAAGGGGGGGCGG + Intergenic
1160059947 18:75520333-75520355 GAGGGAGAAAAAATGAGGGAAGG - Intergenic
1160919228 19:1512083-1512105 CAGGGGGAAAGAGGGGGGAAGGG + Intronic
1160947489 19:1650514-1650536 GAGTCTGAAAAATGGGGGGAGGG + Intronic
1160965268 19:1744608-1744630 GAGGGTGAGAAAGGGGAGGAAGG - Intergenic
1161222600 19:3124589-3124611 CAGGGAGACAAAAGGTAGGATGG - Intergenic
1161369928 19:3905362-3905384 CAGGTAGGAAAATGGGGGGAAGG + Intronic
1161910734 19:7191857-7191879 GAGAGTGAAAGAAGGAGGGAAGG + Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1163311108 19:16515043-16515065 GAGGGTAAAAAAAGAGGTGAGGG - Intronic
1164447689 19:28331813-28331835 CAGAGTGAAAAATGGAGGCAAGG + Intergenic
1164477856 19:28589046-28589068 AGGGATGAAAAAAGGGGGGAGGG + Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165209595 19:34223385-34223407 CAGGCTTACAAAAGGGAGGATGG - Intronic
1165266131 19:34664874-34664896 GAGGATGAAGAAAGAGGGGAGGG - Intronic
1166488145 19:43231689-43231711 TGGGGTGGGAAAAGGGGGGAGGG + Intronic
1166592170 19:44009234-44009256 CAGGGTGATATAAGTGGGCATGG - Intronic
1166762816 19:45235374-45235396 CAGGGCGGAAAAATGGAGGAGGG + Intronic
1167130220 19:47580499-47580521 TAGGGTGAAAAAAGAAGGAAAGG + Intergenic
1167324091 19:48813350-48813372 TGGGGAGAAAAGAGGGGGGAAGG + Intronic
1167418475 19:49389535-49389557 CAGGGTGCAAAGGGGGGCGATGG - Intronic
1168107455 19:54173371-54173393 CTGGGTGATAAACGGTGGGAAGG - Intergenic
925233052 2:2252818-2252840 AAGGGGGAAGAAAGAGGGGAAGG - Intronic
925411274 2:3641187-3641209 CAGGGAGAAAAGAGAGGGGCTGG + Intronic
926247819 2:11133599-11133621 CAGGGTGGAAAAGGGAGGGCAGG - Intronic
926312764 2:11686409-11686431 CAGGGTGAAACAGGAGAGGAGGG + Intronic
927012144 2:18914948-18914970 GAGGGTGAAAGAAGTGCGGAAGG + Intergenic
927481384 2:23456920-23456942 GAGGGAGAAAAAAGGTGGTAGGG + Intronic
928275835 2:29899329-29899351 CAGGGGGCAAAAAAGGGGCAAGG - Intronic
929914375 2:46121974-46121996 CAATGGGAAAAAAGGAGGGAAGG - Intronic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930052737 2:47229051-47229073 TTGGGTGAAAAAGGGCGGGAGGG - Intergenic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
931470576 2:62534754-62534776 GAGGGGGAAAAAAGGAAGGAAGG - Intergenic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
931997477 2:67853025-67853047 CAGGGTGAATGAGGAGGGGATGG + Intergenic
931999012 2:67866578-67866600 CAGGGTGAGAAAAGGGTTGGGGG + Intergenic
932222605 2:70011332-70011354 CAGGTTGAAAACAGGGGGCAGGG + Intergenic
932449474 2:71800399-71800421 AAGGAAGAGAAAAGGGGGGAGGG - Intergenic
932465649 2:71922472-71922494 CAGGGAGAGAAAAGGGGGTCTGG - Intergenic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
934946048 2:98542813-98542835 CAGGGTAACAGAAGGGGGAAGGG - Intronic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
936272359 2:111058782-111058804 AAGGATAAAAAAAGGAGGGAGGG + Intronic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
936611505 2:114006271-114006293 CAGGGGGAAAAAGGGTGGGAAGG + Intergenic
936846794 2:116844308-116844330 GAGGAAGAAAAAAGGGGGGCAGG - Intergenic
937057367 2:118950791-118950813 GAGGAAAAAAAAAGGGGGGAGGG - Intronic
937703565 2:124891948-124891970 CAGGGAGAAGAAAGCAGGGACGG - Intronic
938051621 2:128177978-128178000 CAAGATGCAAAAAGGAGGGATGG - Intronic
938811435 2:134856651-134856673 CTGGGTGAAAAAAGGGGCAAAGG - Intronic
938912674 2:135899596-135899618 GAAGGTAAAAAAAGGAGGGAGGG - Intergenic
938940361 2:136164417-136164439 CAGTGCGAGAATAGGGGGGATGG + Intergenic
939083650 2:137690692-137690714 TAGGCTAAAAAAATGGGGGATGG + Intergenic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
940316303 2:152330966-152330988 CAGGCAGAAAGCAGGGGGGAAGG - Intergenic
940812028 2:158255293-158255315 CAGGAAAAAAAAAGGGGGGCGGG + Intronic
940816898 2:158306678-158306700 CAGGGTGGGGGAAGGGGGGAGGG + Intronic
940887455 2:159001921-159001943 CTGGGTGAAAAGAGGAGGGTTGG + Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
942257529 2:174119136-174119158 AAGGCTGAAAGAAGTGGGGATGG - Intronic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942945491 2:181667701-181667723 TAGGGTGAAAAATGGGGGAGAGG - Intronic
943821644 2:192330509-192330531 AAGGGGGAAGAAAGGAGGGAAGG + Intergenic
944052384 2:195485270-195485292 CAGGATGATATAAGGGTGGATGG + Intergenic
944930121 2:204508743-204508765 CAGACTGAAAAAAGGAGGGGAGG + Intergenic
945014722 2:205503058-205503080 AAGGGAGGAAAAAGGGGAGAGGG - Intronic
945556316 2:211280770-211280792 GAGGTTGAAAAAAAAGGGGAAGG - Intergenic
946479998 2:220045914-220045936 CAGGGTGAAAATAAGGGGCATGG + Intergenic
946579788 2:221115873-221115895 CAGGGTTAAAAATGGGGAAAGGG - Intergenic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
947035495 2:225849250-225849272 GAGGGAGAAAAATGGGGGAACGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948218501 2:236250541-236250563 CCAGGTAAAAAAAGGGGTGAAGG - Intronic
948983514 2:241507194-241507216 CAGAGTCAAAAAAGTGGGGAGGG + Intronic
1168765323 20:378445-378467 AGGGGTGAAGAAAGGTGGGAGGG - Intronic
1169914739 20:10673875-10673897 CTGCATGGAAAAAGGGGGGAGGG + Exonic
1170749872 20:19136125-19136147 TAGGGTGAAAAATGTGGGGATGG - Intergenic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171012519 20:21516315-21516337 CCAGGGGAAAAAAGGGGGGAAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172574299 20:35995402-35995424 CTGGGTGAAAAAAAGGGTGGGGG - Intronic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1173167476 20:40695636-40695658 CAGGTTGAAGAAAGATGGGATGG - Intergenic
1173201958 20:40960975-40960997 GAGGGGGAAGAAAAGGGGGAGGG + Intergenic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173683780 20:44908827-44908849 CAGAGTTAAAAAATGGGGAAGGG - Intergenic
1173757645 20:45532067-45532089 AAGGGAGAAGAAAGGGGTGAAGG - Intergenic
1173846499 20:46191930-46191952 CAGAGTGAAAGAAGGAGGGAGGG - Intronic
1174336140 20:49862195-49862217 CCAGGTGAAGAAATGGGGGAAGG - Intronic
1174584171 20:51594487-51594509 TTGGGTGAAAAAAGGGGGGTGGG + Intergenic
1174826110 20:53770354-53770376 CAGGGTGATTAAGGTGGGGAAGG - Intergenic
1175735143 20:61380535-61380557 AGGGGTGAAAACAGGTGGGAGGG - Intronic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1178135238 21:29619475-29619497 CAGGGGGAAAAGAGTGGGAAGGG + Intronic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1179255906 21:39715018-39715040 AAGGGAGAAAAAAGGAAGGAAGG - Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1181058598 22:20271339-20271361 CGAGGTGAACAAAGGAGGGATGG - Intronic
1181388001 22:22558638-22558660 CAGGGTGGAAAAAGGGGGTGCGG + Intronic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182568905 22:31221331-31221353 ACGGGGCAAAAAAGGGGGGAAGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182735375 22:32529310-32529332 CAGGGTGAGAAAGGAGGGGGCGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1184451187 22:44583860-44583882 CAGAGGGAAATAAGGGGGGAGGG - Intergenic
1184550322 22:45200953-45200975 CCAGGTGAAGAAGGGGGGGAAGG + Intronic
1184656125 22:45943158-45943180 GAGGGAGAAACAGGGGGGGAAGG - Intronic
949094762 3:73192-73214 CAGAGTGAAAACAATGGGGAGGG - Intergenic
949379988 3:3433641-3433663 GAGGGAGAAGAAAGGAGGGATGG + Intergenic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
949699777 3:6743172-6743194 AAGGATGCAAAAAGGGGAGAAGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950478882 3:13232497-13232519 CAGGGAGAAGAAAGGCGGGGAGG + Intergenic
950795904 3:15510689-15510711 CAGAGTGAGACAAGGAGGGAAGG + Intronic
950890044 3:16396552-16396574 TAGAGTGAAAAAAGAGAGGAGGG + Intronic
951054968 3:18136920-18136942 GAGTTTGAAAAAAGGAGGGAGGG + Intronic
951269539 3:20607941-20607963 CAGGGGGTAAAACAGGGGGAAGG + Intergenic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
952719096 3:36513838-36513860 GAGGGAGCAAAAGGGGGGGAGGG + Intronic
953107493 3:39898496-39898518 CAGGCTAGAAAAAGGGGGCAGGG + Intronic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953792241 3:45956611-45956633 TAGGCTGAAAAAAGGGGCCAGGG + Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955004598 3:54956913-54956935 TAGGTTGAAAACAGGGGTGAAGG + Intronic
955279193 3:57578117-57578139 CAGAGTAATAAAAGGGGGGTGGG + Intronic
955849192 3:63201888-63201910 CAGTAGAAAAAAAGGGGGGAAGG - Intergenic
955919364 3:63939344-63939366 CAGGGTGAAAGACATGGGGATGG - Intronic
956189305 3:66593377-66593399 GGGTGTGAAAAAAGGGTGGAGGG + Intergenic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956551755 3:70468607-70468629 CAGGGAGAAAAAAGAAAGGAAGG - Intergenic
956633537 3:71340134-71340156 CAGTGGGAAAATAGGGGGGCAGG - Intronic
957951001 3:87126267-87126289 GAGGGTGAAACAAGAGGAGAAGG + Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
959921419 3:111872419-111872441 CAAGGTGACAACAGGAGGGAGGG - Intronic
960268603 3:115649875-115649897 CTGAGGGAAAAAAGAGGGGAGGG - Intronic
960734549 3:120764184-120764206 CAGGGGAAAAAAAGCAGGGAAGG - Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962435977 3:135367029-135367051 GGGGGTGAAAGAAGGAGGGATGG + Intergenic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962742273 3:138370469-138370491 CAGGGTGACAGAAATGGGGAGGG - Intronic
962922129 3:139959738-139959760 TAGAGTAAAAAAAGGGGGGCGGG - Intronic
963707040 3:148699800-148699822 CAGGGGGAAAAAAGGTGGCGGGG - Intronic
965219670 3:165912614-165912636 CAGGTAGAAAAAAGTGGGAAAGG - Intergenic
967007721 3:185400030-185400052 CAGGGTAGAAAATGGAGGGAGGG - Intronic
967015716 3:185479867-185479889 AATGTTGAAAAAAGGTGGGAGGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967229173 3:187321306-187321328 CAGAGTGAAAAAGGCAGGGACGG + Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
969208685 4:5669610-5669632 CAGGGAGACAGAAGGGGAGAAGG - Intronic
969467469 4:7366270-7366292 CAGGTTTAAAAAAGAGGGCAGGG - Intronic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
974501253 4:62706356-62706378 CAGGGTGAAACATGTGGAGAGGG + Intergenic
975940898 4:79644370-79644392 TAGGTTAAAAAAAAGGGGGAAGG - Intergenic
976526408 4:86096274-86096296 TAGGATTAAAAAAGGTGGGAGGG + Intronic
976570974 4:86610482-86610504 CAGGGGCAAAAAAGGGGCCAGGG + Intronic
976665221 4:87583469-87583491 GAGAGAGAAAAGAGGGGGGAAGG - Intergenic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
976970324 4:91095122-91095144 CAGGATGACAATAGGGGGCAAGG - Intronic
977186199 4:93940400-93940422 GAGGGTGAAGGAAGGTGGGATGG - Intergenic
977239242 4:94546832-94546854 CAGGTTGAAAAAGGTGGGGGGGG - Intronic
977269819 4:94903260-94903282 CGGGGATAAAAAAGGGGGTAAGG - Intronic
977421817 4:96810444-96810466 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
978500207 4:109401089-109401111 AAGGTTTAAAAAAGGGGGAAAGG + Intergenic
979383199 4:120033041-120033063 GAGGGAGAAAAAAGGGGGAGAGG + Intergenic
979565011 4:122145396-122145418 AAGGGAGAAAAAAGTGGGAAGGG - Intergenic
979627603 4:122863335-122863357 AAGGGAGAAAAAAGGATGGAAGG - Intronic
980099731 4:128529676-128529698 AGGGGAGAAAAAAGGGGGGGTGG - Intergenic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981594390 4:146402616-146402638 AAAGGGGAAAAAAGGGGGCAGGG + Intronic
982023819 4:151232242-151232264 GAGGGTAAAAACAGTGGGGATGG - Intronic
983213628 4:164982226-164982248 CTGGTTAAAAAAAGGAGGGATGG + Intergenic
983222622 4:165056991-165057013 CAGAGTGAAAAATAGGTGGAAGG + Intergenic
983523056 4:168730838-168730860 GAGGGTGAAAAATGGGGGTAAGG - Intronic
984400509 4:179257809-179257831 CAAAATGAAACAAGGGGGGAAGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985659136 5:1147200-1147222 CACGGTGACAGAAGGGAGGAGGG + Intergenic
985756664 5:1723522-1723544 CAGGGAGAGAGAAGGAGGGAAGG - Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987265088 5:16245187-16245209 CAGGAAGAAAAAATGTGGGATGG - Intergenic
988731309 5:33975880-33975902 CAGGGAGAAGGAAGGGGGAATGG - Intronic
990672395 5:58147735-58147757 GAGGGTGGAAAAAAGAGGGAAGG - Intergenic
990851519 5:60210618-60210640 CAGGTTAAAAAAATTGGGGAGGG - Intronic
991043459 5:62198305-62198327 TCTGATGAAAAAAGGGGGGAGGG + Intergenic
991249152 5:64540794-64540816 CAGGCAGAAGAAAGGAGGGAGGG + Intronic
993096982 5:83490890-83490912 AAGAGAGAAAAAAGGGGGAAAGG - Intronic
993275983 5:85859312-85859334 GAGGGAGAAAAATGGGGGAATGG + Intergenic
993450746 5:88069904-88069926 CAGCCAGAAAAAAGTGGGGAGGG - Intergenic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
994681145 5:102889136-102889158 CAGGCTGAAGAAGGGTGGGAAGG - Intronic
995415849 5:111912202-111912224 CATGATGAAAAAAGGGTGCAAGG - Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996430849 5:123375172-123375194 CTGGGGGAAAAAAAGGGGGTAGG - Intronic
996781504 5:127191813-127191835 CAGGATTAAAAAAGATGGGAGGG + Intergenic
997883784 5:137613169-137613191 CAGGATGAAAAAGAAGGGGAGGG - Intergenic
998135692 5:139673316-139673338 CAAGGTCAAAAAATGGGGAAGGG + Intronic
998669631 5:144339385-144339407 CATGGGGAAAAAAGGAGAGAGGG - Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999384984 5:151147763-151147785 CAGCTTGAAAAAAGGAGGAAAGG - Intronic
1000204441 5:159045353-159045375 AGGGGAGAAAAAAGGAGGGAGGG - Intronic
1000946250 5:167427083-167427105 AAGGATGAAAGAAGTGGGGAAGG + Intronic
1002180867 5:177430543-177430565 CCCGGTGAAGAAAGGGGAGAAGG - Intronic
1002408485 5:179054758-179054780 CAGGATGACAATAGGGGGCAAGG - Intergenic
1003102595 6:3188414-3188436 CAGGGTGATAAAGGCGGGAAGGG + Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003448339 6:6205955-6205977 CAGAGTGGTAAAAGGGGGTAGGG - Intronic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1004345374 6:14844385-14844407 AACGGTGATAAAAGGGGTGAGGG - Intergenic
1004477807 6:15990004-15990026 CAGGGTGACAAATTGTGGGAAGG - Intergenic
1004715565 6:18213492-18213514 CAGGGGGAAAAAAGGAGGTGAGG + Intronic
1005469786 6:26151377-26151399 CAGGTGGAAAGAAGGGGGAATGG - Intergenic
1005665103 6:28044441-28044463 AAGGAAGAAAAAAGGGGGGAGGG + Intergenic
1005857653 6:29874823-29874845 AAGGGAGAAAGAAGGAGGGAAGG - Intergenic
1005865811 6:29935179-29935201 AAGGGAGAAAGAAGGAGGGAAGG - Intergenic
1005909095 6:30292487-30292509 CACGGTGAAAAAAGGAAGGGAGG - Intergenic
1006033846 6:31197038-31197060 CAGAGTGGAGAAAGGAGGGAAGG - Intergenic
1006176570 6:32125992-32126014 CAGGGAGAAAAAGGTGGGGAGGG - Intronic
1006391806 6:33763036-33763058 CAGGGAGGGAAAAGGAGGGAAGG + Intergenic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007467203 6:42062045-42062067 CAGGGAAAAAAAAGAGGAGAGGG - Intronic
1007756711 6:44104199-44104221 CAGGGTGGAAAAGGGTGAGAGGG + Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1010751480 6:79620608-79620630 CAGCCTGAAAAAAAGGGGAAGGG + Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012210368 6:96510853-96510875 CAGGGGGAAGAAAGAGGGAAAGG - Intergenic
1012953877 6:105547884-105547906 GAGGTAGAAAAAAGGGAGGAAGG + Intergenic
1012962008 6:105631866-105631888 CATGGTGGAAATAGGGGAGAGGG - Intergenic
1013465429 6:110413770-110413792 CAGGGGGAAAAAAAAGGGAAGGG - Intronic
1014076789 6:117244982-117245004 CCGAGTCAAAAAAGGGGTGACGG + Intergenic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014779122 6:125543097-125543119 AAGCATGAAAAAAGTGGGGATGG - Intergenic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1016981019 6:149854275-149854297 AAGAGTGAAAATAGGTGGGAAGG - Intronic
1017607329 6:156148048-156148070 CAGGGTGCAAAAGAGAGGGAGGG + Intergenic
1018869531 6:167770488-167770510 CAAGGAGAAAGGAGGGGGGAAGG - Intergenic
1019127938 6:169853701-169853723 CAGAATGCAAAAAGGGGAGAAGG - Intergenic
1019385473 7:753338-753360 CAGAGTGAAAGAAGCGGAGAAGG + Intronic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1020797798 7:12697615-12697637 CAGGGGGAAGCAAGTGGGGAAGG - Intergenic
1021028173 7:15695319-15695341 CAGGGGGAAAAAGAGGTGGAGGG + Intergenic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1021470229 7:20994150-20994172 CTGGGTGAAAAACTGGGGCAGGG + Intergenic
1021881969 7:25103955-25103977 GAGCGTGAAAAAAGGGGAAATGG - Intergenic
1022560842 7:31347261-31347283 AAGGGAGAAAAAAGGAGGCATGG + Intergenic
1022897817 7:34770600-34770622 TAGGCTGGAAAATGGGGGGAGGG + Intronic
1023310611 7:38882617-38882639 CAGGGTGAAAATAGTGGTGGTGG - Intronic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1023587294 7:41743956-41743978 CAGGGAGAGAAAAGGGTGAAAGG - Intergenic
1023737494 7:43247935-43247957 GAGAGAGAAAAAAGGAGGGAAGG + Intronic
1023743321 7:43300478-43300500 GAGGGTGGAAGAAGGGTGGAAGG + Intronic
1024579152 7:50787885-50787907 CAGGGTGAAAAGATGGGCGGGGG + Intronic
1024631722 7:51254566-51254588 GAGGATGGAAAAATGGGGGATGG - Intronic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1025084319 7:56010206-56010228 CTGGAGGAAAAATGGGGGGAGGG - Intergenic
1025925419 7:65955683-65955705 GACGGTGAAGAAAGGAGGGAAGG - Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027638515 7:80704935-80704957 CTGGGTGAAAGAAGTGGGGAAGG - Intergenic
1028555463 7:92118777-92118799 CATGGTGAAAAAGGAGGGCAAGG + Intronic
1028627299 7:92891439-92891461 GAGGATGGAAAATGGGGGGAAGG + Intergenic
1029358745 7:100072610-100072632 GTTGGTGAGAAAAGGGGGGAAGG + Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG + Intronic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1033225874 7:139561755-139561777 TAGGGTGAGAAAAAGGGGGGGGG - Exonic
1033288156 7:140060232-140060254 CAGGTTGAAACAAGGTGGGCTGG + Intronic
1033608359 7:142943496-142943518 CAGGGTGGAAGAATGGGGGTTGG + Exonic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033969867 7:147025506-147025528 CGGGGAGAAGAAAGTGGGGAGGG + Intronic
1034252896 7:149706554-149706576 GAGGGAGAGAAAGGGGGGGAAGG - Intergenic
1034899258 7:154897416-154897438 CAGCAGGAAAAAAGGGCGGAAGG - Intergenic
1035096465 7:156360103-156360125 CAGGGTGAGATAAGGGGAGGTGG - Intergenic
1035454673 7:159000192-159000214 GAGGGTGAAAGAACGGGGGACGG + Intergenic
1036036623 8:5027523-5027545 CACAGTGAAAAGAGGTGGGATGG - Intergenic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1038664097 8:29522563-29522585 AACGTTAAAAAAAGGGGGGAGGG + Intergenic
1039023117 8:33229082-33229104 AAGGTTGAGAAAAAGGGGGATGG - Intergenic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1043404542 8:79917037-79917059 CCAGGTGAAAAATGGAGGGAGGG + Intergenic
1043733648 8:83717510-83717532 CAGTGTGGGAAAATGGGGGAAGG + Intergenic
1044070826 8:87757343-87757365 AAGGGGAAAAAAAGGAGGGAAGG + Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044539378 8:93392511-93392533 GAGGGAGAAAACAGGGGTGATGG - Intergenic
1044974224 8:97647522-97647544 CTGTCTAAAAAAAGGGGGGAAGG + Intronic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045174755 8:99710547-99710569 CAGAGTGAAATAAAGGGGAAAGG + Intronic
1045229076 8:100283371-100283393 TAGGGAGAAAAATTGGGGGAGGG - Intronic
1045399672 8:101800898-101800920 GAGGGGGAAAAAAGGGGAGGGGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1049056311 8:140239969-140239991 CAGAGTACAATAAGGGGGGAAGG + Intronic
1049083167 8:140458029-140458051 AGGGGTGAAAGAAGGAGGGAGGG + Intronic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1049825137 8:144662969-144662991 CAAGGTGAATAATGGGGAGAAGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050306220 9:4308382-4308404 CAGGGTCAAAGAAGAGGAGAAGG + Intronic
1050738026 9:8786744-8786766 CAGGGAAAAAAAAGGTGGGGGGG + Intronic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1053020590 9:34691395-34691417 CAGGGGGAAGAAGGGGGGCAGGG - Intergenic
1053329160 9:37188492-37188514 GAGGGGGAAGGAAGGGGGGAGGG - Intronic
1055563230 9:77542838-77542860 CAGGCTGAAGTAATGGGGGAAGG + Intronic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1055915055 9:81392189-81392211 CTGGCTGGAAAAAGGGGAGACGG + Intergenic
1057006171 9:91562171-91562193 CAGTGTCAAAAAAGGAAGGAAGG + Intergenic
1057873019 9:98732319-98732341 CAGCGGGTAAAAAGGGGGCAGGG - Exonic
1058316541 9:103573982-103574004 CAGGGTGGAAGATGGGAGGAGGG + Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1061234473 9:129334560-129334582 CAGGGCGGGAAAAGGCGGGAGGG - Intergenic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1061543838 9:131292321-131292343 CATGGGGAAAGAAGGTGGGAAGG - Intronic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1185965024 X:4590542-4590564 GAGGGTGGAAGAAGGGAGGAAGG + Intergenic
1186771428 X:12821717-12821739 CACAGTGAAAAAATGGGGGTGGG + Intronic
1186878588 X:13841606-13841628 GAGGCTGAAGAAAGGGGTGAGGG - Intronic
1187249453 X:17583679-17583701 CAGGGTGAGGCAAGGTGGGATGG - Intronic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187391935 X:18891750-18891772 CAGGGTGACCCAAGGGGGCAGGG + Intergenic
1187619469 X:21034658-21034680 CAGGGTGAAAAAATGGGGGTGGG - Intergenic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1188177587 X:27010986-27011008 AAGAGTGAAAGAAGGAGGGAAGG - Intergenic
1189319371 X:40078419-40078441 AAGGGTGCAAGAAGGGTGGAAGG + Intronic
1189871656 X:45390595-45390617 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
1191253690 X:58270859-58270881 CCGGGGGAAAAAAGCCGGGAGGG - Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1191873468 X:65770046-65770068 CAGGATGAAGAAAGGGTGAAGGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1195282447 X:103349002-103349024 CAGGGTGAAGGAAGAGTGGAGGG - Intergenic
1195843442 X:109200195-109200217 CAGGGTGAAAAAGGAAAGGAGGG + Intergenic
1195928091 X:110046490-110046512 GAGGCTGAAAAAAGGTGGGATGG + Intronic
1196143349 X:112290318-112290340 CAGGGTGAAATAATGATGGAAGG + Intergenic
1196423149 X:115543435-115543457 AAGGGGGGAAAAAGGGGGGGTGG - Intergenic
1196783979 X:119406437-119406459 CTGGGAGAAAATAGGGGGAAAGG - Intronic
1196896383 X:120340930-120340952 CAGGGGGAAAAAGGTGGGAAGGG + Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197391709 X:125875362-125875384 TAGGCTAAAAAAAGGGGGGATGG - Intergenic
1197630159 X:128849126-128849148 CATGCTCAAAAAAGGGGGAAAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197701029 X:129599797-129599819 CAGTCTGAAAAAATGGGGGATGG - Intergenic
1197999230 X:132414657-132414679 TATGATGAAAAAAGGGGGGATGG - Intronic
1198215355 X:134549897-134549919 CGGGGAGAAAAAACGGAGGATGG + Intergenic
1198969770 X:142267817-142267839 CAGGATGACAATAGGGGGCAAGG + Intergenic
1199199558 X:145071220-145071242 CAGGATGAAAAAATTGGGGGAGG - Intergenic
1199571551 X:149271795-149271817 GGAGGTGAAAGAAGGGGGGAGGG - Intergenic
1199585881 X:149415333-149415355 CAGGGCCAGAAAAGGGGGCAAGG - Intergenic
1201517709 Y:14835707-14835729 GAGGGAGAAAAAAGAGGGAATGG + Intronic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic