ID: 1116637581

View in Genome Browser
Species Human (GRCh38)
Location 14:47416887-47416909
Sequence CTCTGGGTTTGTAATGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 2, 2: 14, 3: 100, 4: 629}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116637569_1116637581 18 Left 1116637569 14:47416846-47416868 CCATGAAATCATTCTGCTCCCAC 0: 1
1: 1
2: 2
3: 29
4: 246
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637578_1116637581 -10 Left 1116637578 14:47416874-47416896 CCATGCACTTGCACTCTGGGTTT 0: 1
1: 0
2: 0
3: 17
4: 222
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637570_1116637581 0 Left 1116637570 14:47416864-47416886 CCCACCCTCCCCATGCACTTGCA 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637571_1116637581 -1 Left 1116637571 14:47416865-47416887 CCACCCTCCCCATGCACTTGCAC 0: 1
1: 0
2: 4
3: 35
4: 410
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637576_1116637581 -8 Left 1116637576 14:47416872-47416894 CCCCATGCACTTGCACTCTGGGT 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637573_1116637581 -5 Left 1116637573 14:47416869-47416891 CCTCCCCATGCACTTGCACTCTG 0: 1
1: 0
2: 0
3: 16
4: 273
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637577_1116637581 -9 Left 1116637577 14:47416873-47416895 CCCATGCACTTGCACTCTGGGTT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629
1116637572_1116637581 -4 Left 1116637572 14:47416868-47416890 CCCTCCCCATGCACTTGCACTCT 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG 0: 1
1: 2
2: 14
3: 100
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116637581 Original CRISPR CTCTGGGTTTGTAATGGAAA GGG Intronic
900041076 1:464768-464790 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
900062507 1:699744-699766 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
900822812 1:4902172-4902194 CTCTGGGTCTGTGATGGAAGGGG + Intergenic
900852243 1:5153397-5153419 CTCTGGGCTTGTAATGGGAGGGG - Intergenic
901082650 1:6592349-6592371 CCCTGGGTTTCTCTTGGAAATGG - Exonic
901124728 1:6920910-6920932 CTCTGGGCCTGTGATGGAAGAGG + Intronic
901211635 1:7529776-7529798 GGTTGGGTTTTTAATGGAAATGG + Intronic
902084454 1:13848425-13848447 CTCTGGGTCTGTGATGGAAGGGG - Intergenic
904823974 1:33262739-33262761 GTCAGGGGTGGTAATGGAAAAGG - Intronic
905419963 1:37834801-37834823 CTCTGGTTTTCTAGTGGCAAAGG - Intronic
906437000 1:45804247-45804269 GCCTGGGGTTGTATTGGAAATGG + Intronic
907495605 1:54842194-54842216 CTCTGGCTTTAGAATAGAAAGGG - Exonic
907808165 1:57841764-57841786 CTCTGGGTTTGTGATGTGAGGGG + Intronic
907935818 1:59041425-59041447 CTGTGGGATTGTAAAGGACAGGG - Intergenic
908234261 1:62134939-62134961 CCCAGGGTTGGAAATGGAAAAGG + Intronic
908549351 1:65193349-65193371 CTCTGGGTCTGTGATGGGAGGGG + Intronic
908900614 1:68952298-68952320 CTCTGGGTTTGTGATGGGAGGGG - Intergenic
909185415 1:72480308-72480330 CTCTGGGCTTGTGATGGGAAGGG + Intergenic
909265314 1:73550332-73550354 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
909457737 1:75869494-75869516 CTCTGGGCCTGTAATGGAAGGGG - Intronic
909792204 1:79693529-79693551 CTCTGGGATTGTGCTGGGAAGGG + Intergenic
909826053 1:80127945-80127967 CTCTGGGCCTGTAATGGAAGTGG + Intergenic
910270320 1:85387059-85387081 CTCTGGGTCTGTGATGGGAAAGG + Intronic
910469695 1:87539074-87539096 CTCTGGGCATGTGATGGAAGGGG - Intergenic
911051273 1:93673654-93673676 CTCTGGGTTTGTAATGGGCCTGG - Intronic
911238015 1:95432589-95432611 TTCTGGTTTTGAAAAGGAAAAGG + Intergenic
911840544 1:102675992-102676014 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
912165619 1:107039658-107039680 CTCTGGGCTTGTGATGGAAGGGG - Intergenic
912721924 1:112027638-112027660 TTCTGGCCTTTTAATGGAAAGGG + Intergenic
913254254 1:116939553-116939575 TCCTGGGCTTGTAATGGGAAGGG + Intronic
913298926 1:117350033-117350055 CTCTGGCTGTAAAATGGAAAAGG - Intergenic
914351674 1:146845170-146845192 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
915654899 1:157351177-157351199 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
915752331 1:158223597-158223619 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
916987480 1:170207398-170207420 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
917281947 1:173386075-173386097 CTCTGGGCCTGTGATGCAAATGG - Intergenic
918531208 1:185524327-185524349 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
918613972 1:186523610-186523632 CTCTGGGCCTGTAATGGGAAGGG - Intergenic
918727725 1:187947438-187947460 CTCTGGGCTTGTGATGGGAGAGG - Intergenic
918784509 1:188748589-188748611 CTCTAGGCTTGTGATGGGAAGGG - Intergenic
919273698 1:195384963-195384985 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
919277041 1:195433794-195433816 ATCTTGGTTTGAAATGGACAAGG - Intergenic
919291973 1:195643921-195643943 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
919426227 1:197434976-197434998 CAGTGGGTCTGTCATGGAAAGGG - Exonic
920836883 1:209519517-209519539 TTCTGGGTCTGTAATGGGAAGGG - Intergenic
921755871 1:218855393-218855415 CTCTGGGTCTGTGATGCAAGGGG - Intergenic
921763142 1:218940392-218940414 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
921792675 1:219308471-219308493 CTCTGGGTCTGTGATGGGAGAGG - Intergenic
922011044 1:221587985-221588007 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
922303435 1:224323700-224323722 CTCTGGGTTTGTGTTGGCAGTGG - Intronic
923032451 1:230260411-230260433 TTCTGTCTTTGTAATAGAAAAGG - Intronic
924252498 1:242146966-242146988 CTGTGGTTTTCTAATGGTAATGG - Intronic
1063767577 10:9160406-9160428 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1064696740 10:17974998-17975020 CTCTGCCTTTGTAAAGGGAAGGG - Intronic
1064776585 10:18785276-18785298 CTCTGTGTTTGGAGTGGGAATGG - Intergenic
1064904409 10:20330410-20330432 CTCTGGGTCTGTAATGAGAGAGG - Intergenic
1065405310 10:25357411-25357433 CTCCGGGCCTGTAATGGGAAAGG - Intronic
1065645584 10:27830723-27830745 CTCTGGGTTGGTCCTGGAAAAGG - Intronic
1066290232 10:34007795-34007817 CTCTGGGCTTGGCATTGAAAAGG - Intergenic
1067710893 10:48650355-48650377 CTCTGGATTTGTCATGTAAATGG - Intronic
1068155090 10:53187982-53188004 CTCTGGGTCTGTGATGGGAAGGG - Intergenic
1068454574 10:57238365-57238387 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1069095084 10:64249492-64249514 CTCTGGGCTTGTGATGGAAGGGG + Intergenic
1069118020 10:64532631-64532653 CTCTAGTTTTGTATTGGAAGAGG - Intergenic
1069870198 10:71528418-71528440 CTCTGGGTGAGTTATGGGAAGGG - Intronic
1070376064 10:75831987-75832009 CTCTGGGTCTGTGATGGAAGGGG + Intronic
1070832999 10:79431734-79431756 TTTTACGTTTGTAATGGAAATGG - Intronic
1070868841 10:79729968-79729990 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071018998 10:81029847-81029869 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1071635756 10:87252187-87252209 CTCTGTGGCTGGAATGGAAATGG + Intergenic
1071659487 10:87485789-87485811 CTCTGTGGCTGGAATGGAAATGG - Intergenic
1071934214 10:90508824-90508846 CTCTGGGCCTGTGATGGAAAGGG + Intergenic
1073841585 10:107504207-107504229 CTCTGGGCCTGTAATGGGACAGG + Intergenic
1076967349 11:100998-101020 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
1078301507 11:10135294-10135316 CTCTGGGTCTGTGATGGCAGGGG + Intronic
1078496770 11:11825125-11825147 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1078651017 11:13191988-13192010 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1078698577 11:13659596-13659618 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1078994806 11:16686110-16686132 CTCTGGGTCTGTGATGGAAGGGG + Intronic
1079181996 11:18201770-18201792 CTCTGGGCCTGTGATGGGAAGGG + Intronic
1079652168 11:22942892-22942914 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1079769686 11:24444206-24444228 CTCTGGGTCTGTGATGGGAGAGG - Intergenic
1079972954 11:27059055-27059077 CTCTGGGTCTGTGATGGGAGAGG - Intronic
1080477500 11:32609024-32609046 TTCTGGGTTTGTGATGGGAAGGG + Intronic
1080577458 11:33613105-33613127 CTCTGGGTATATAATAGTAATGG + Intronic
1080903942 11:36522202-36522224 CTCTGGGCTTGTGATGGGAGGGG - Intronic
1081120090 11:39255573-39255595 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1081175412 11:39921946-39921968 CTCTGGGTTTGTGATAGGAGGGG - Intergenic
1081224359 11:40501717-40501739 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1081580922 11:44351194-44351216 CTTTGTGTTTGAAGTGGAAATGG - Intergenic
1081887681 11:46512843-46512865 CTCTGAGTTGGTAATTGACAGGG - Intronic
1084012305 11:66359215-66359237 CTCTGGGGCTGCAATGAAAAGGG + Intronic
1085851344 11:80124194-80124216 CTCAGGGCCTGTGATGGAAAAGG - Intergenic
1086799434 11:91152905-91152927 CTCTGGGTCTGTCATGGGATGGG + Intergenic
1086840295 11:91676395-91676417 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1087271177 11:96113652-96113674 CTATGGGTTTGCATTTGAAATGG + Intronic
1087364392 11:97200985-97201007 CTGTGGGGTTGGAATGGCAAAGG + Intergenic
1087690719 11:101317756-101317778 CTCCAGGTTTGTGATGGGAAGGG + Intergenic
1087789722 11:102393345-102393367 CTCTGGGGTGGTAATGGCACTGG + Intergenic
1087831776 11:102826436-102826458 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1088121947 11:106380378-106380400 CTCTGGGCTTGGAATTGAATTGG + Intergenic
1088663411 11:112071282-112071304 ATCTGTGTGTGTAATTGAAAGGG + Exonic
1088784292 11:113166416-113166438 CACTGGATTTGTAATGGTAGAGG - Intronic
1089284851 11:117398829-117398851 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1089345387 11:117787997-117788019 CTCTGGGTTTTGAATGGACTTGG - Intronic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1089929849 11:122298829-122298851 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1090105845 11:123853262-123853284 CTCTGGGCCTGTAATGGAAGGGG - Intergenic
1090193353 11:124792948-124792970 CTCTGGCTTTCTAATGGCAAGGG + Intronic
1090629300 11:128632568-128632590 CTCTGGGTAGCTGATGGAAAAGG - Intergenic
1090881098 11:130831829-130831851 CAGTGGGGTTGTCATGGAAACGG - Intergenic
1091086390 11:132725438-132725460 CTCTGGGACTGTAATGGGAGGGG + Intronic
1091146137 11:133282200-133282222 CTCTGGGTCTGTGATGGGAAGGG - Intronic
1091409249 12:228483-228505 GTCTGTGTTCCTAATGGAAAGGG + Intronic
1091993845 12:4977477-4977499 CTCAAGCATTGTAATGGAAATGG + Intergenic
1092459141 12:8671097-8671119 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1092870125 12:12798824-12798846 CTGTGGGTGTGTATTGGGAAGGG - Intronic
1092916160 12:13191138-13191160 ATCTGTGTTTGGAATGGCAAAGG + Intergenic
1093242317 12:16692337-16692359 CTCTGTGAGTGTAATAGAAAGGG + Intergenic
1093788094 12:23215847-23215869 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1093973893 12:25400569-25400591 CTCTGGGTCTGTAATGGGAGGGG - Intergenic
1095399188 12:41795059-41795081 CTCTGGGTTTCTCATTAAAAAGG - Intergenic
1095544185 12:43345271-43345293 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1095782755 12:46078260-46078282 CTCTGGGCTTGTAATGGAAGGGG + Intergenic
1095919345 12:47513966-47513988 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1098434037 12:70450387-70450409 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1098660580 12:73087999-73088021 ATCTGGTTCTGTAATGGGAAGGG + Intergenic
1098686917 12:73433991-73434013 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1099386395 12:82018635-82018657 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1099429747 12:82569031-82569053 CTCTGTGCTTGATATGGAAAAGG - Intergenic
1099746206 12:86708091-86708113 CTCTGGGCCTGTGATGGAAGCGG - Intronic
1100072271 12:90735216-90735238 CTCTGGGTCTGTGATGCAAGGGG + Intergenic
1100123373 12:91394986-91395008 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1101083719 12:101214529-101214551 CTCTGGGCCTGTGATGGGAAAGG - Intergenic
1101692719 12:107096648-107096670 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1102148672 12:110673571-110673593 CTCTGGGTCTGTGATGGGAGGGG - Intronic
1102918162 12:116771097-116771119 CTCTCTGTTTTTAAAGGAAAAGG + Intronic
1104580882 12:130009951-130009973 TTCTGCATTTGTAAAGGAAAGGG + Intergenic
1104762818 12:131307540-131307562 CTCTGAGTGTGGACTGGAAAGGG + Intergenic
1104817107 12:131653843-131653865 CTCTGAGTGTGGACTGGAAAGGG - Intergenic
1105644612 13:22303504-22303526 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1106301640 13:28471638-28471660 CTGTAGGTTTGTTATGTAAATGG - Intronic
1106496824 13:30286264-30286286 CTCTGGGCTTGTGATGGGAGGGG - Intronic
1106551964 13:30780047-30780069 CTCTGGGTCTGTGATGGAAGAGG - Intergenic
1106631581 13:31479638-31479660 CTCTGGGTTTGTGATGGGAGGGG + Intergenic
1106929795 13:34651999-34652021 CTCTGGGTCTGTGATGGCAGGGG - Intergenic
1107053027 13:36072787-36072809 CTGTGGTTTTGTAATGGATTTGG - Intronic
1107354959 13:39557166-39557188 TTCTGGGTTTGTGATGGGAGTGG - Intronic
1108113011 13:47097506-47097528 CTCTAGCTTCGTAATGGATAAGG + Intergenic
1108156764 13:47592860-47592882 CTCTGGGCCTGTAATGGGAGTGG + Intergenic
1108632890 13:52303337-52303359 CTCTGTGTTTGTGATGGCAGTGG + Intergenic
1108981857 13:56523936-56523958 CTCTGGGTCTGTGATGGGAATGG + Intergenic
1108989649 13:56639108-56639130 CTGTGGGTTTGTACTGCCAAAGG - Intergenic
1109189582 13:59308359-59308381 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1109391776 13:61704063-61704085 CTCTGGGTCTGTAATGGGAGGGG - Intergenic
1109524379 13:63556872-63556894 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1109569406 13:64166493-64166515 CTCTGGGTTTGTAAATGAGGCGG + Intergenic
1110189448 13:72714554-72714576 CTCAGGGCCTGTAATGGGAAGGG - Intronic
1110955783 13:81550382-81550404 CTCTGGGTCTGTGATGGAAGGGG + Intergenic
1111064453 13:83072529-83072551 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1111083455 13:83342767-83342789 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1111085627 13:83372273-83372295 CTCTAGGTCTGTGATGGAAGGGG + Intergenic
1112067839 13:95813756-95813778 CTCTGGGCCTGTAATGGGAAGGG - Intronic
1112815480 13:103268199-103268221 CTCTAGGTCTGTGATGGGAAGGG - Intergenic
1113732671 13:112653222-112653244 CTCTGCGTCCATAATGGAAAGGG - Intronic
1113732683 13:112653278-112653300 CTCTGCGTTTGTAATGGAAAGGG - Intronic
1114646001 14:24256470-24256492 CTCTGGGTTGGTTATGATAAAGG - Intronic
1115010796 14:28542280-28542302 CTCTGCCTTTGTAGTGTAAAAGG - Intergenic
1115893860 14:38061803-38061825 CTCTGGGGCTGTGATGGGAAGGG + Intergenic
1115936644 14:38559931-38559953 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1115968260 14:38916058-38916080 CTCTGGGCCTGTAATGGGAGGGG + Intergenic
1116024235 14:39496720-39496742 CTCTAGGCCTGTAATGGGAAGGG - Intergenic
1116389670 14:44377249-44377271 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1116742617 14:48776326-48776348 CTCCAGGTTTGTGATGGGAAGGG - Intergenic
1117181902 14:53200255-53200277 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118836017 14:69478310-69478332 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1120564491 14:86038222-86038244 CTCTGGGTCTGTGATTGAAGGGG - Intergenic
1121095324 14:91214397-91214419 CTTTGGGCATGTGATGGAAAAGG + Intronic
1121382964 14:93490156-93490178 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1121392867 14:93590781-93590803 CTTGGGCTTTGTCATGGAAATGG + Intronic
1121503944 14:94462067-94462089 CTGCGGGTTTGTAACGGCAATGG - Intergenic
1122157479 14:99758883-99758905 CTCTGGGTTTGCAAAGAAATTGG + Intronic
1123696932 15:22885053-22885075 CTCTGGGTTTATGATGGGAGGGG + Intronic
1123872962 15:24594838-24594860 CACTGGGCCTGTAATGGGAAGGG + Intergenic
1124066245 15:26346913-26346935 CTCTGGGCTTGTGATGGTAGAGG - Intergenic
1124806149 15:32885202-32885224 CTTTGGGTTGGAATTGGAAAGGG - Intronic
1126266222 15:46756502-46756524 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1126427640 15:48546703-48546725 CTCAGGAGTTGAAATGGAAAGGG + Intronic
1130791417 15:87160100-87160122 CTCTGGGTCTGTGATGGGAGAGG - Intergenic
1131422044 15:92315080-92315102 GTTGGGGTTTGTAATGGTAAAGG - Intergenic
1131573147 15:93559586-93559608 CTCTGGGTTTGCAATAGATAAGG + Intergenic
1132440825 15:101862827-101862849 CTCTGGGTGTGTGATGGAAGGGG - Intergenic
1135906496 16:26516911-26516933 CTCTGTGTGTGTCAAGGAAATGG - Intergenic
1135912343 16:26572520-26572542 CCCTGGGCTTGTGATGGAAGGGG + Intergenic
1135919086 16:26632025-26632047 CTCTGGGTCTGTAATGGAAGGGG + Intergenic
1136081376 16:27854467-27854489 CCCAGGGGATGTAATGGAAAGGG - Intronic
1139331167 16:66191718-66191740 TCCTGGGATTGTATTGGAAAGGG - Intergenic
1139963908 16:70734831-70734853 CTCTGTGTATATAATGGGAATGG - Intronic
1139982361 16:70870366-70870388 CTCTGGGTCTGTGATGGGAGGGG - Intronic
1140802819 16:78504772-78504794 CTCTGGATTTGGCATGTAAACGG - Intronic
1140939964 16:79712308-79712330 CTTTGTGTTTGCAATGGCAATGG + Intergenic
1141295451 16:82763975-82763997 CCCTGGATTTGAAAAGGAAAGGG + Intronic
1144257197 17:13480803-13480825 CTCTGGGCCTGTGATGGAAGAGG - Intergenic
1149110266 17:53019615-53019637 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1149800228 17:59560751-59560773 TTCTGGTTTTTTAATGGAGAAGG + Intergenic
1149853182 17:60054053-60054075 CTCTGGGTGTGTGATGGGAGGGG - Intronic
1150313003 17:64144983-64145005 CTATGGGTTTGTAGTTGAATGGG - Intergenic
1152967502 18:130202-130224 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1153388959 18:4533117-4533139 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1153481799 18:5554637-5554659 CTCTGGGTGTGTGGTGGAAGAGG - Intronic
1154926480 18:20941847-20941869 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1155515956 18:26624339-26624361 CTCTGGGCCTGTGATGGGAATGG - Intronic
1155675596 18:28425560-28425582 CTCTGGGTCTGTGATGGGAAGGG - Intergenic
1156769116 18:40698271-40698293 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1157003136 18:43550636-43550658 CTCTGGGCCTGTAATGGGAGTGG + Intergenic
1157034303 18:43953009-43953031 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1158057765 18:53302352-53302374 TTCTGGGTTTTGATTGGAAATGG - Intronic
1158359969 18:56660955-56660977 CTCAGAGTTTAAAATGGAAATGG + Intronic
1159176724 18:64845913-64845935 TTTTGGGTGTGTAATGCAAATGG - Intergenic
1159261348 18:66016529-66016551 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1159265558 18:66073969-66073991 CTCTGGGTCTGTAATAGGAGGGG + Intergenic
1159705376 18:71679661-71679683 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1159760466 18:72419584-72419606 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1160258304 18:77265902-77265924 CTCTGGGTGTGTGATGGGAAAGG + Intronic
1160583780 18:79901728-79901750 CTCTGGGTTTTAACAGGAAATGG - Intergenic
1160644152 19:170621-170643 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
1162569932 19:11465846-11465868 CCCTGCTTTTGTCATGGAAATGG - Intronic
1163056849 19:14726296-14726318 TTCTGGGTTTGTGATGGGAGAGG + Intronic
1163684805 19:18705486-18705508 CTTTGTGTTTTTAATGGAGATGG + Intronic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164045127 19:21531303-21531325 CTATGGATTTGTAATAGAGAGGG - Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164214070 19:23128819-23128841 CTCTGGGCCTGTGATGGAAGGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165959233 19:39520512-39520534 TTCTGGGGTTGTGAGGGAAACGG + Exonic
1166008888 19:39926758-39926780 CTGTTGGTTTGTTCTGGAAAGGG - Intronic
1166062603 19:40336061-40336083 CTCTGGGTTTGGCATGGAGGTGG - Intronic
1167687811 19:50967747-50967769 AGTTGGGTTTGTAATGGGAATGG - Intronic
1168702393 19:58449006-58449028 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
925264162 2:2552921-2552943 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
925554386 2:5114085-5114107 CTCTAGGTATGTGATGGGAAGGG - Intergenic
925594721 2:5544101-5544123 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
926431081 2:12786148-12786170 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
927030621 2:19117160-19117182 CTCTGGGTCTGTGATGGGAAGGG + Intergenic
928048829 2:27968143-27968165 CTCTGGGCCTGTAATGGGAGGGG - Intronic
928812762 2:35248774-35248796 CTCTGGGTCTGTGATGGGAGTGG + Intergenic
928828874 2:35455113-35455135 CTCTGCCTTTGGAAAGGAAATGG - Intergenic
929260681 2:39863819-39863841 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
930170463 2:48246617-48246639 TTCTGGGCCTGTGATGGAAAAGG - Intergenic
930427899 2:51234431-51234453 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
930940876 2:57013354-57013376 CTCTGGGCTTGTGATGGGAGTGG - Intergenic
931162273 2:59704800-59704822 CTCTGGGCCTGTGATGGAAGTGG + Intergenic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
932318057 2:70799285-70799307 CTCTGGGTCTGTAATGGGAGAGG + Intergenic
932588861 2:73050642-73050664 CTCTGGGTCTGTGATGGATGTGG + Intronic
933008295 2:77023293-77023315 CTCTGGGTCTGTGATGGGAGAGG + Intronic
934891981 2:98078442-98078464 CTCTGGGCCTGTAATGGGAGGGG + Intergenic
934979985 2:98831762-98831784 CTCTTGGATTCTAATGGAGAAGG + Intronic
935369724 2:102332638-102332660 CTATGGGTTTGTGGTGGAAGAGG + Intronic
935448824 2:103187045-103187067 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
935673077 2:105572000-105572022 CTCTGGGGTCCTAATGGGAAGGG - Intergenic
936984654 2:118297328-118297350 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
937762484 2:125622693-125622715 CTCTGGGCTTGTGATGGGATGGG - Intergenic
938010903 2:127828300-127828322 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
939243571 2:139594346-139594368 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
939605796 2:144253894-144253916 CTCTGGGCCTGTGATGGAAGGGG - Intronic
939842565 2:147206487-147206509 TTCTGGGCTTGTGATGGGAAGGG + Intergenic
940133601 2:150411681-150411703 CTCTGGATTTCTCATTGAAATGG - Intergenic
940135882 2:150435665-150435687 CTCTGGGCCTGTAATGGAAGGGG - Intergenic
940451619 2:153844485-153844507 CTCTGGGCCTGTAATGGAAGGGG + Intergenic
940728377 2:157361695-157361717 CTCTGGGCCTGTAATGGGATGGG - Intergenic
941142851 2:161806255-161806277 CTCTGGGTCTGTGATGGGAGGGG + Intronic
941184888 2:162309382-162309404 CTCTGGGTCTGTGGTGGAAGTGG + Intronic
941337889 2:164267962-164267984 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
941452040 2:165671613-165671635 CTCTGGGACTGTAATGGGAGGGG + Intronic
942033654 2:171989412-171989434 ATTTGTGTTTGTAATAGAAATGG - Intronic
942234275 2:173889367-173889389 CTCTAGGTTTGTGATGGGAGGGG - Intergenic
942281158 2:174364847-174364869 CTCTGGGCCTGTAATGGGAGGGG + Intronic
942656388 2:178218492-178218514 TTCTGGGTTGGTAATGGAAATGG + Intronic
942727475 2:179026219-179026241 CTCTGGGCTTGTGATGGAAGGGG - Intronic
942803640 2:179903681-179903703 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
942870798 2:180732345-180732367 CTCTGGGCCTGTAATAGAAGTGG - Intergenic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
943212772 2:184989436-184989458 CTCTGGGCCTGTTATGGGAAAGG - Intergenic
943246021 2:185451577-185451599 CTCTGGGCCTGTAATGGGAGGGG + Intergenic
943395508 2:187328535-187328557 CTCTGGGCCTGTGATGGAAGAGG - Intergenic
943478960 2:188394896-188394918 CTCTGGGGTTGGAATGGCAAAGG + Intronic
943832849 2:192485040-192485062 CTCTGGGTTTGTGATGGGAGAGG - Intergenic
943876127 2:193070746-193070768 CTCTTGGACTGTAATGGCAAGGG - Intergenic
945515929 2:210763035-210763057 CTCTAGGTCTGTGATGGACAGGG + Intergenic
945644033 2:212467325-212467347 CTCTGGGCCTGTGATGGAAGGGG - Intronic
945713427 2:213329783-213329805 CTCTGGGCTTGTGATGGCAGGGG - Intronic
945718494 2:213387849-213387871 TTCTGGGTTTCTGCTGGAAATGG + Intronic
945760107 2:213903582-213903604 CTCTGGGTCTGTGATGGGAGGGG + Intronic
946317196 2:218924074-218924096 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
946355440 2:219181665-219181687 CTCTGAGTCTGTAATGGCCAAGG - Exonic
946544024 2:220716520-220716542 CTCCAGGTCTGTAATGGGAAGGG + Intergenic
946937388 2:224736328-224736350 CTCTGGACCTGTAATGGGAAGGG - Intergenic
947008493 2:225538605-225538627 CTCTAGGCTTGTAATGGGAGAGG + Intronic
947047601 2:226005643-226005665 CTCTGGGCCTGTGATGGGAATGG + Intergenic
947345644 2:229186669-229186691 CTCTGGGCCTGTGATGGAAGGGG + Intronic
948104191 2:235400066-235400088 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
948138532 2:235655887-235655909 CCCTGGGTTTTGTATGGAAAAGG + Intronic
948209832 2:236184868-236184890 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
948531258 2:238607087-238607109 CTCTGGGCTGGTAATGGGAGTGG - Intergenic
1168982167 20:2015040-2015062 ATTTGGTTTTGTAATGGACATGG - Intergenic
1169766375 20:9152324-9152346 CTCTGGGTCTGTGATGGGAAGGG - Intronic
1169858048 20:10124460-10124482 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1170062438 20:12273155-12273177 CTCTGGGCTTGTGATGGGAGAGG + Intergenic
1170238789 20:14139061-14139083 CTTTTTGTTTTTAATGGAAAAGG - Intronic
1170318588 20:15069491-15069513 CTCTGGGCCTGTGATGGGAAGGG - Intronic
1170480009 20:16755934-16755956 CTCTGGGCCTGTGATGGGAAGGG + Intronic
1170499678 20:16961494-16961516 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1170938500 20:20829841-20829863 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1171118762 20:22549799-22549821 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1171534247 20:25872473-25872495 CCCTGGGTTTGTGATGGGAGGGG - Intergenic
1171571437 20:26255359-26255381 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1172499241 20:35413216-35413238 CTCTTGGGATGTAATGGAAGAGG - Intergenic
1172644357 20:36460928-36460950 CTCTGGGTTAGCAAAGCAAAGGG + Intronic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1173566551 20:44042918-44042940 GCCTGGGGTTGTAAGGGAAAGGG + Intronic
1174499727 20:50975763-50975785 ATCGGGGATTGTAATGGGAATGG - Intergenic
1174589972 20:51637160-51637182 CTCTGGGATAGTAGTAGAAATGG - Intronic
1175013636 20:55764986-55765008 CTCTGGGTTTGTGATGGGAGGGG + Intergenic
1175255608 20:57645125-57645147 CTCTGGGCCTATAATGGGAAGGG - Intergenic
1175910336 20:62402336-62402358 CTTTGGGTTTCTAATGGGGATGG - Intronic
1176314425 21:5228689-5228711 CTCTGGGTGTGCCATAGAAAAGG - Intergenic
1176687257 21:9862120-9862142 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1177026379 21:15925843-15925865 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1177186981 21:17808084-17808106 CTCTGGGCCTGTGATGGGAAGGG - Intronic
1177358307 21:20037399-20037421 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1177554480 21:22672059-22672081 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1177684574 21:24419220-24419242 CTCTGGGCTTGTGATGGGAAGGG + Intergenic
1178004141 21:28197135-28197157 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1179272002 21:39858655-39858677 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1179527877 21:41995729-41995751 CTCTGGGCCTGTGATGGAAGGGG - Intronic
1179967707 21:44816956-44816978 CACTGGGGGTGTGATGGAAAGGG + Intronic
1180638371 22:17278636-17278658 TTCTGTATTTTTAATGGAAATGG + Intergenic
1182866716 22:33610767-33610789 CTCTGGGCCTGTAATGGGAGGGG - Intronic
1183956631 22:41384175-41384197 CTCTGGATTTATAAGTGAAAAGG - Intronic
1184274109 22:43400449-43400471 TTCTTGGTTTGTAATGGGGAGGG + Intergenic
1184904699 22:47473041-47473063 CTCTGGGCTTGTGATGGACATGG + Intronic
949611742 3:5709888-5709910 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
950368159 3:12503934-12503956 CTCTGGGGTTTTAGTTGAAATGG - Intronic
950468451 3:13170046-13170068 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
951965481 3:28379774-28379796 CTCTAGTTTTGCTATGGAAAAGG - Intronic
952541231 3:34370493-34370515 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
954094067 3:48309103-48309125 CTGTGAGTTTGTCATGGAGATGG + Intronic
955119657 3:56044812-56044834 CTCTGGGTTTGTATTTGATTTGG - Intronic
955465310 3:59230617-59230639 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
955651711 3:61201877-61201899 TTCTGTGTTTGAAGTGGAAAGGG - Intronic
955833296 3:63026904-63026926 CTCTGGGCCTGTAACGGGAAGGG + Intergenic
956160069 3:66341996-66342018 CCCTGGGGTTGAATTGGAAAAGG + Intronic
956246325 3:67186897-67186919 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
956564056 3:70615467-70615489 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
956938642 3:74132116-74132138 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
957113127 3:75992233-75992255 CTCTGGGCCTGTGATGGGAAGGG - Intronic
957191308 3:77013338-77013360 AGTTGGGTTTATAATGGAAAAGG + Intronic
957200871 3:77134574-77134596 CTGTTGGTTTATAATTGAAAGGG - Intronic
957609842 3:82452719-82452741 CTCTGGGTCTGTGATGGGATGGG - Intergenic
957790618 3:84936533-84936555 CTCTGAGACTGTGATGGAAAGGG - Intergenic
958110541 3:89137933-89137955 CTCAGGGTTTCTAATGCAACAGG - Intronic
958836825 3:99156466-99156488 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
958890070 3:99773336-99773358 TTCTGGGTTTTTAAGGGGAATGG + Intronic
959051051 3:101525707-101525729 CTCTGGGCCTGTAATGGGATGGG - Intergenic
959695735 3:109246766-109246788 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
959809228 3:110595160-110595182 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
960009241 3:112815368-112815390 CTCTGGGCTTGTTGTGGGAAGGG - Intronic
960352303 3:116608035-116608057 CTATGGGGTTATATTGGAAAGGG - Intronic
963143375 3:141966675-141966697 CTATGCGTTTATTATGGAAAAGG + Intronic
963270630 3:143282630-143282652 GTCTGGAATTGTAATGGTAATGG + Intronic
963494546 3:146042966-146042988 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
963539525 3:146567310-146567332 CTCCTAGTTTGTAATGGGAAGGG + Intergenic
963672424 3:148268754-148268776 CTCTGAGCTTGTAATGGAGGTGG + Intergenic
964098654 3:152962915-152962937 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
964324696 3:155533697-155533719 CTCTGGGTCTGTGATGGGAGGGG - Intronic
964605473 3:158556082-158556104 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
964793277 3:160472581-160472603 CTCTGGGTATCTAATAGACAGGG + Intronic
964910729 3:161777060-161777082 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
965031125 3:163369414-163369436 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
965132626 3:164721342-164721364 TTCTAGGTTTTTAATGGTAATGG - Intergenic
965270754 3:166614111-166614133 CTCTGGGTCTGTGATGGGACGGG + Intergenic
965275516 3:166677320-166677342 CTCTGAGTCTGTAATGGGAAGGG + Intergenic
965366950 3:167812908-167812930 GTCTATTTTTGTAATGGAAATGG + Intronic
965394988 3:168152573-168152595 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
965661182 3:171043818-171043840 CTCTGCGACTGTCATGGAAAGGG + Intergenic
965812226 3:172603023-172603045 CCCTGGGTCAGTGATGGAAAGGG - Intergenic
965870026 3:173253620-173253642 CCCTGGGTCTGTAATGGGAGGGG + Intergenic
965884245 3:173424242-173424264 CTCTGGGTCTGTCATGGGAGGGG + Intronic
965931143 3:174044200-174044222 CTCTGGGCTTGTGATGCTAAGGG + Intronic
966208098 3:177425101-177425123 GTCTGGGACTGTAATGGGAAGGG + Intergenic
966302642 3:178496582-178496604 CTCTGGGCCTGTGATGGGAATGG - Intronic
966338827 3:178902559-178902581 CTCTGAGTCTGTGATGGAAGTGG - Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
967208505 3:187145661-187145683 CTCTGGGCTTGTGATGGGAGGGG + Intronic
967305702 3:188057059-188057081 CTCCTGGTTTGTACTGGAAAGGG - Intergenic
967509458 3:190292451-190292473 CTCTGGGCCTATGATGGAAAGGG + Intergenic
970049474 4:11897544-11897566 CTCTGGGTCTGTAATGGGAGGGG - Intergenic
970357360 4:15269342-15269364 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
970758184 4:19451158-19451180 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
971277958 4:25215749-25215771 CTCTGGGTTTGTGATGGGAGGGG + Intronic
971488473 4:27186718-27186740 CTCTGGGATTTTAAGGGAAAAGG + Intergenic
971499283 4:27300884-27300906 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
971594457 4:28510923-28510945 CTCTGGGCTTGTAAAATAAAGGG - Intergenic
972199915 4:36702510-36702532 CTTTGGGCTTGTGATGGGAAGGG - Intergenic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
972799733 4:42462278-42462300 CTCTGGGCCTGTGATGGAAGGGG - Intronic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
974011127 4:56608480-56608502 CTCTGGGCTTGTGATGGGAGTGG - Intergenic
974290383 4:59921678-59921700 CTCTGCCTTTGGAAAGGAAAGGG + Intergenic
974311023 4:60209877-60209899 CTCTGGGCCTGTCATGGAAGGGG + Intergenic
974448578 4:62019047-62019069 CTTTGGATTTGTAATCAAAATGG + Intronic
974653795 4:64791331-64791353 CTCTGGCCTTGTAATGATAATGG + Intergenic
974832834 4:67210874-67210896 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
974963388 4:68730991-68731013 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
975240106 4:72047328-72047350 CTCTGGGCCTATAATGGAAGGGG - Intronic
975816573 4:78223191-78223213 CTCTTGGTTTGGAATGGGGATGG + Intronic
975816585 4:78223240-78223262 CTCTTGGTTTGGAATGGGGATGG + Intronic
976260305 4:83139122-83139144 CTGTGGCTTTGTAAGGGAAGAGG - Intergenic
977197922 4:94084343-94084365 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
977366024 4:96068646-96068668 CTCTGGGTCTGTAATGGGAGGGG + Intergenic
977503991 4:97878677-97878699 CTCTGGGTCTGTGATGGGAGGGG + Intronic
977702561 4:100036398-100036420 CTCTGGGTGTGTGATGGGAGGGG + Intergenic
977820923 4:101472009-101472031 CTCCGGGATTGTGATGGAAGAGG - Intronic
977905027 4:102467545-102467567 TTCTGGGCCTGTAATGGACAGGG - Intergenic
978083455 4:104621607-104621629 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
978265900 4:106823555-106823577 CTCTGGGCCTGTAATGGGAGAGG + Intergenic
979063501 4:116098149-116098171 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
979420788 4:120502656-120502678 CTCTGGGCCTGTAATGGGAGGGG + Intergenic
979849310 4:125556577-125556599 CTCTGGGTTTGTGATGAGAGGGG + Intergenic
979974866 4:127184472-127184494 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
980408268 4:132381564-132381586 CTCTAGGTCTGTGATGGAAGGGG + Intergenic
980654643 4:135766209-135766231 CTCTGGGTCTGTAATGTAGCAGG + Intergenic
980747820 4:137042966-137042988 CTCTTGGTTTTGAAGGGAAAAGG + Intergenic
981548287 4:145916497-145916519 CTCTGGGCCTGTGATGGAAGGGG + Intronic
981642992 4:146967042-146967064 CCCTGGGCCTGTGATGGAAAGGG - Intergenic
981683280 4:147424534-147424556 CTCTGGGTTTGTTATATAGAAGG + Intergenic
981820413 4:148880502-148880524 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
981872874 4:149507855-149507877 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
982287134 4:153747085-153747107 CTCTGGGCTTGTGATGGGAGGGG + Intronic
982309952 4:153974558-153974580 CTCTGGGCCTGTGATGGGAAAGG - Intergenic
982622318 4:157723871-157723893 CTCTGGGTTTGTGATGGAGGGGG - Intergenic
982834745 4:160109558-160109580 CTCTGGGCCTGTGATGGGAAAGG + Intergenic
982911065 4:161143959-161143981 CTCTGGGCTTGTCATGGGAGGGG - Intergenic
983245667 4:165284094-165284116 CTCTGGGCCTGTGATGGAAGGGG + Intronic
983419657 4:167501026-167501048 TTCTGGGTCTGTGATGGAAGGGG + Intergenic
983703897 4:170633753-170633775 CTCTGTATTTGAAATGGATATGG + Intergenic
983889434 4:173015867-173015889 CTCTGGGTCTGTGATGGGAGGGG - Intronic
984232143 4:177112280-177112302 CTCTGGGCCTGTGATGGAAGAGG + Intergenic
984517040 4:180753338-180753360 CTCTGGGTTTGTGATGAGAGAGG + Intergenic
985076735 4:186223896-186223918 CTCTGGGCTTGTAATGGGAGGGG - Intronic
987459993 5:18197904-18197926 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
987543509 5:19284346-19284368 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
987737432 5:21865463-21865485 CACTGGGCTTGTGATGGCAAAGG - Intronic
987838859 5:23197052-23197074 CTCTTGGTTTCTAATTTAAAGGG + Intergenic
987894394 5:23925828-23925850 CTCTGGGTTTGTGATGGGAGGGG + Intergenic
987916845 5:24226470-24226492 CTGTTGGGTTGTAATGGCAAGGG + Intergenic
988221282 5:28349451-28349473 CTCAGGGTCTGTAATGGGAGGGG + Intergenic
988886363 5:35562995-35563017 CTCAGGGCTTGTAATGGAAGGGG - Intergenic
988894511 5:35657469-35657491 CACTGGGTATGGAATGGAATCGG + Intronic
989499448 5:42149233-42149255 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
989696877 5:44212265-44212287 CTCTGGGCTTGTGATGGGAGAGG - Intergenic
990005739 5:50942307-50942329 ATGTGGGTTTGTAATAGATAGGG - Intergenic
990037819 5:51343788-51343810 CTTTGGGTTTTTAATAGAAGAGG - Intergenic
990329543 5:54712649-54712671 CTCTGGGTCTGTGATGGAATGGG - Intergenic
990370445 5:55113103-55113125 GTGTGGGTGTGTAAAGGAAAAGG + Intronic
990595508 5:57309181-57309203 CTCTGGGTCTGTGATGGGAGAGG - Intergenic
991119475 5:62994412-62994434 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
991204789 5:64038437-64038459 CTCTGGGTCTGTGATTGGAAGGG - Intergenic
992924407 5:81567190-81567212 CTCTGGGCCTGTGATGGAAGGGG - Intronic
993442470 5:87973560-87973582 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
993690667 5:90996207-90996229 CTCTGGGCTTGTAATGGGATAGG - Intronic
993792589 5:92224820-92224842 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
994073792 5:95629120-95629142 CTCTGGGCCTGTAATGGGAAGGG + Intergenic
994115744 5:96059711-96059733 CTCTGAATGTGTAATGGAATGGG + Intergenic
994175268 5:96703450-96703472 CTCAGGTTGTGTAAAGGAAATGG - Intronic
994253944 5:97570447-97570469 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
994614974 5:102092624-102092646 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
994621750 5:102172313-102172335 CTCTGGGCCTGTAATGGGAGTGG - Intergenic
994649030 5:102504110-102504132 CTCTGGGCTTGTAATGGGAAGGG - Intergenic
994689573 5:102999866-102999888 CACTGGGTCTGTGATGGAAGGGG + Intronic
994813785 5:104557192-104557214 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
994956924 5:106544834-106544856 CTCTGGGGTTGTAGTTGAATGGG + Intergenic
995393219 5:111661409-111661431 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
996011305 5:118483884-118483906 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
996284213 5:121769903-121769925 CTTTGGGCTTGTCATGGAAGGGG - Intergenic
996640282 5:125743662-125743684 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
997274669 5:132574472-132574494 CTCTGGGCTTGTGATGGGAGGGG + Intronic
997492071 5:134285560-134285582 CTCTGGGTCTGTAATGGGAGGGG + Intergenic
997857059 5:137381758-137381780 CTCTGGGCCTGTAATGGGAGAGG + Intronic
998255965 5:140588395-140588417 CTCTGGGCTTTTCATGTAAATGG - Intronic
998576708 5:143324524-143324546 CTCTGGGCCTGTGATGGGAAGGG + Intronic
999012258 5:148055982-148056004 CTCTGGGCATGTAATGGGAGGGG - Intronic
999096220 5:148980193-148980215 CTCTGGGAATGGAATAGAAAAGG - Intronic
999571571 5:152925542-152925564 CTCTGGGTCTGAGATGGGAAGGG - Intergenic
999906109 5:156143015-156143037 CTCTGGGCCTGTGATGGGAAGGG - Intronic
1000141043 5:158403892-158403914 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1000203820 5:159038098-159038120 CTCTGGGATTGCAAAGGACAAGG - Intronic
1000262441 5:159600564-159600586 CTCTGGTTCTGTAATGGGAAGGG + Intergenic
1000751157 5:165097824-165097846 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1000768380 5:165319366-165319388 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1000947148 5:167436635-167436657 CTCTGGGTCTGTGATGGGACAGG - Intronic
1001927662 5:175650157-175650179 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1002671319 5:180869994-180870016 CTCTGGGTTTCTTATGGGACTGG + Intergenic
1002732769 5:181354160-181354182 CTCTGGGTGTGTGATGGAAGGGG - Intergenic
1002751768 6:119946-119968 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
1002777502 6:341520-341542 CTCTGGGCTTTTCTTGGAAAAGG + Intronic
1003004283 6:2366501-2366523 ATCTTGGTTTGTAATTGTAAAGG + Intergenic
1004245580 6:13972499-13972521 CTCTGGGTCTGTGATGGGAGGGG - Intronic
1005815721 6:29550754-29550776 CTCTGGATTTGAAATGGAGTTGG - Intergenic
1006062921 6:31439026-31439048 CTCTGGGCTTGTGATGGGAGAGG - Intergenic
1008242190 6:49127381-49127403 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1008713547 6:54259988-54260010 CACTGGGTTTGTAACTGAAATGG - Intronic
1009289534 6:61866465-61866487 CTCTGGGCCTGTGATGGAAGGGG + Intronic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009621620 6:66085054-66085076 CTCTGTGTTTGCATTGGCAATGG + Intergenic
1009710198 6:67308410-67308432 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1009811577 6:68674586-68674608 CTCTTGGTTTATCATGCAAAGGG + Intronic
1009825015 6:68856834-68856856 CTCTGGGCCTGTGATGGGAAGGG - Intronic
1010078133 6:71825393-71825415 CTCTGTGTTTATTAAGGAAATGG - Intergenic
1010364060 6:75029454-75029476 GTATGGGTTGGAAATGGAAAAGG + Intergenic
1010590593 6:77707654-77707676 CTCTGGGCCTGTGATGGAAGGGG - Intronic
1010636098 6:78260652-78260674 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1010713843 6:79206293-79206315 CTCTGGGCCTGTAATGGGAGAGG - Intronic
1010900506 6:81422559-81422581 CTCTGGGTCTGTGATGGGATGGG - Intergenic
1011155755 6:84329253-84329275 CTCTGGCATTGTGATGTAAACGG + Intergenic
1011544453 6:88468672-88468694 CTATGGGTCTGTGATGGAAGGGG - Intergenic
1011821164 6:91255582-91255604 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1012239881 6:96859973-96859995 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1012732521 6:102900249-102900271 CTCTAGGCTTGTGATGGGAAGGG + Intergenic
1012767422 6:103386659-103386681 CTCTGGGTCTGTGATAGAAGGGG - Intergenic
1012788229 6:103658668-103658690 CTCTGGGCTTGTGATGGGAAGGG + Intergenic
1012825192 6:104138926-104138948 GACTGGTTTTGAAATGGAAAAGG - Intergenic
1013118486 6:107121108-107121130 ATCTGGGTTGTGAATGGAAAAGG + Intergenic
1014101673 6:117517875-117517897 CTCTGGGTCTGTGATGGGAAGGG + Intronic
1014327646 6:120018623-120018645 CTCTGGGTCTGTAATGGGGGTGG + Intergenic
1014509840 6:122307725-122307747 CTCTGGGCCTGTTATGGGAAGGG - Intergenic
1014549967 6:122779059-122779081 CTCTCGGTTTGTGTTGGGAAAGG + Intergenic
1014661816 6:124181300-124181322 CTCTGGGTCTATAATGGGAGGGG + Intronic
1014715773 6:124862676-124862698 CTCTGGGTCTGTGATGGCAGGGG + Intergenic
1015415176 6:132940125-132940147 CTCTGGGTCTGGGATGGAAGGGG - Intergenic
1015901660 6:138074509-138074531 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1016175186 6:141071451-141071473 CTCTGGGCCTGTGATGGGAATGG - Intergenic
1016176263 6:141081181-141081203 CTCTGGGCCTGTGATGGCAAGGG - Intergenic
1016475247 6:144420083-144420105 CTCTGAGTTTGAAATGGAGGAGG - Intronic
1016477409 6:144442029-144442051 CTCTGGGCTTGTGATGGGAGGGG + Intronic
1016537580 6:145126143-145126165 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1017624388 6:156333466-156333488 TTCTGGGGTGGTAATGTAAATGG + Intergenic
1017938142 6:159025181-159025203 CTCTGGGCCTGTAATAGGAAGGG + Intergenic
1018167979 6:161117299-161117321 CTGCAGGTTTGTAATGCAAAAGG + Exonic
1018503931 6:164443699-164443721 CTCTGGGCCTATGATGGAAATGG - Intergenic
1018555338 6:165043796-165043818 CCAAGGGTTTGTAATGGAACAGG + Intergenic
1019050674 6:169180516-169180538 CTCTGGGTCTGTGATGGAAGTGG + Intergenic
1019081576 6:169434937-169434959 CTCTGGGCTTGTGATAGAAGGGG - Intergenic
1019098715 6:169609641-169609663 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1019237025 6:170626478-170626500 CTCTGGGTGTGTGATGGAAGGGG - Intergenic
1020515060 7:9107269-9107291 CTCTGGCTTTGGAAAGGTAAAGG + Intergenic
1020550369 7:9596629-9596651 CTCTGGGCATGTGATGGGAAGGG - Intergenic
1020578990 7:9971103-9971125 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1020696490 7:11420244-11420266 CTCTGGGCTTGTGATGGGAGTGG - Intronic
1020731534 7:11887600-11887622 CTCTGGGTCTGTGATGGAAGGGG - Intergenic
1021499927 7:21321130-21321152 CTCTGGGCCAGTGATGGAAATGG - Intergenic
1021769684 7:23985707-23985729 CTGTGGGGTTGGAATGGAAGCGG - Intergenic
1022321560 7:29293058-29293080 CTCTGTCTTTGCAATGGAAGCGG - Intronic
1022650849 7:32273025-32273047 CACTGGCTTTGAAATGGAGATGG + Intronic
1023804051 7:43858864-43858886 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1024403431 7:48950385-48950407 CTCTGGGTATGTAATGGGAGGGG + Intergenic
1024729174 7:52235646-52235668 CTCTGGGACTGTGATGGGAAGGG - Intergenic
1024771650 7:52731108-52731130 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1024822229 7:53345694-53345716 TTCTGGATATGTAATGTAAATGG + Intergenic
1024845415 7:53636473-53636495 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1025285728 7:57659395-57659417 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026553077 7:71384471-71384493 CTGTGGGATTCTGATGGAAAAGG - Intronic
1028041886 7:86063628-86063650 CTCTGGGTCTGTTATGGGAGGGG - Intergenic
1028249743 7:88526510-88526532 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1028253060 7:88558736-88558758 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1029914852 7:104198808-104198830 CTCTGGGCCTGTAATGGGATGGG - Intronic
1030396262 7:108990348-108990370 CTCATGGTTTGGAATGGAACTGG - Intergenic
1030778807 7:113571855-113571877 CTATGAGCTTGTATTGGAAATGG + Intergenic
1030786569 7:113670715-113670737 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1031290454 7:119928219-119928241 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1031478109 7:122247571-122247593 CTCTGGGCCTGTAATGGGAAAGG - Intergenic
1031702391 7:124942538-124942560 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1031703759 7:124958106-124958128 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1031807571 7:126327033-126327055 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1031914166 7:127546561-127546583 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1033063502 7:138129767-138129789 CTCTGGGCCTGTGATGGAAGTGG + Intergenic
1034710428 7:153186091-153186113 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1035510744 8:180132-180154 CTCTGGGTGTGTGATGGAAGGGG + Intergenic
1036021637 8:4853249-4853271 CTCTGGGCCTGTCATGGGAAGGG - Intronic
1036488655 8:9202982-9203004 CTATGGGTTTATATTGGAATTGG - Intergenic
1037155727 8:15696134-15696156 CTCTGGGCCTGTGATGGGAAAGG - Intronic
1037415389 8:18644064-18644086 CTCTGGGACTGTGATGGAATGGG + Intronic
1039083936 8:33760877-33760899 CTCTGGGCCTGTGATGGAAGTGG + Intergenic
1039652093 8:39353336-39353358 CTCTGGGTCTGTGATGGGAAGGG - Intergenic
1039682284 8:39753563-39753585 CTCTGTGTCTGTGATGGGAAGGG - Intronic
1039706313 8:40011079-40011101 TTTTGTGTTTTTAATGGAAATGG + Intronic
1041852034 8:62403412-62403434 CTCTGGGCCTGTAATGAAAGGGG - Intronic
1042055142 8:64756443-64756465 CTCAGGGTTTGTTTTGGAAGCGG + Intronic
1042977384 8:74484989-74485011 GTGTGGGTTTGAAATGGTAAAGG - Intronic
1043199054 8:77340149-77340171 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1043869046 8:85410005-85410027 CTCGGGGTTTAGAAAGGAAATGG + Intronic
1043922542 8:85999898-85999920 CACTGGGTTTCTAATCGGAATGG - Intronic
1044839238 8:96323670-96323692 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1044879876 8:96712737-96712759 CTCTGGGCTTGTAATAGTAGGGG + Intronic
1045043560 8:98251170-98251192 CTCTGGCTATTTCATGGAAACGG + Intronic
1046050095 8:109012455-109012477 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1046244368 8:111539347-111539369 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1046445210 8:114310622-114310644 CTCAGGTCTTATAATGGAAATGG + Intergenic
1048404536 8:134106648-134106670 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1048729239 8:137419044-137419066 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1048755414 8:137732935-137732957 CTCTGGGCTTGTAATGGGAGGGG - Intergenic
1048768219 8:137867529-137867551 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1050067197 9:1772118-1772140 CTCTGGGTTTATGATGAAAATGG + Intergenic
1050412459 9:5381249-5381271 TCCTGGGTTTGTAATGGGAGGGG - Intronic
1050848314 9:10252488-10252510 CTCAGGGTTTCTCATGAAAATGG - Intronic
1050857899 9:10384979-10385001 CTCTATGTTTATAATGTAAATGG + Intronic
1050945355 9:11510729-11510751 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1050974201 9:11915836-11915858 CTCTGGGGCTGTTATGGAAAGGG + Intergenic
1050987569 9:12102346-12102368 CTCTGAGTCTGTGATGGGAAGGG + Intergenic
1051020352 9:12535163-12535185 CTCTGGGCTTGTGATGGAAGGGG + Intergenic
1051267492 9:15323130-15323152 CTCTGGGCCTGTGATGGGAAGGG - Intergenic
1051309748 9:15757669-15757691 CTCTGGGCCTGTGATGGGAAGGG - Intronic
1051612286 9:18972858-18972880 CTCTGGGTTGGAAATGGCCATGG - Intronic
1051990438 9:23145749-23145771 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1052090506 9:24321022-24321044 CTCTGGGCTTGTGATGGAAGGGG + Intergenic
1052176039 9:25463791-25463813 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1052248432 9:26367474-26367496 CTTTGGGTTTCTCATTGAAATGG - Intergenic
1052414278 9:28157452-28157474 CTCTGGGCCTGTGATGCAAAGGG + Intronic
1052577817 9:30312376-30312398 TTCAGGGTTTGTGATGGAAGGGG + Intergenic
1052599103 9:30600674-30600696 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1052721167 9:32172691-32172713 CACTGGATTTATAAGGGAAAGGG + Intergenic
1053782050 9:41619481-41619503 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1054170002 9:61829635-61829657 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1054667536 9:67751180-67751202 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1055782378 9:79833266-79833288 CTCTGGGATTATAATGGAAAGGG + Intergenic
1055794025 9:79955093-79955115 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1055840268 9:80494743-80494765 CTCTGGGTTTGTGATGGGAAAGG + Intergenic
1055976038 9:81955906-81955928 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1056092168 9:83216290-83216312 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1056386776 9:86103096-86103118 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1057426106 9:94951012-94951034 CTCTGTGGTTGTGGTGGAAAAGG + Intronic
1058174488 9:101722046-101722068 CTCTGGGCTTGAAATGGGAGGGG - Intronic
1058330800 9:103757230-103757252 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1059294811 9:113260865-113260887 CCCTGGGTCAGTGATGGAAAGGG + Exonic
1059617612 9:115967716-115967738 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1059796797 9:117706397-117706419 CTCTCCCTTTGTAATGGAATCGG + Intronic
1059929698 9:119248900-119248922 CTTTGGGTTTGGGATGGGAAGGG - Intronic
1060019534 9:120117281-120117303 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1060808877 9:126598118-126598140 CTCTGCTTTTGTTTTGGAAAAGG - Intergenic
1062058613 9:134482478-134482500 CTCTGGGGCTGTGATGGCAAAGG + Intergenic
1062757176 9:138306484-138306506 CTCTGGGTGTGTGATGGAAGGGG - Intergenic
1185878929 X:3723541-3723563 CTCTGGCTTTGTCAGGAAAAAGG - Intergenic
1186613100 X:11158001-11158023 CTCTGCAGTTGGAATGGAAAAGG - Intronic
1186797698 X:13062547-13062569 CTCTGGGCTTGTGATGGTAGAGG + Intergenic
1187180578 X:16939672-16939694 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1187576465 X:20561801-20561823 CTCTGGGCCTATAATGGAAGTGG - Intergenic
1187590800 X:20715054-20715076 CTCTGGGTTATAAAGGGAAAGGG - Intergenic
1187628719 X:21144370-21144392 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1187639704 X:21274391-21274413 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1188187551 X:27133235-27133257 CTCTGGGTTATTACTGGAGAAGG - Intergenic
1188211636 X:27432571-27432593 CTCTGGCTTTGTAATATAAATGG + Intergenic
1188587994 X:31800514-31800536 CTCTGGGCTTGTGATGGGAGGGG + Intronic
1188662401 X:32775710-32775732 CTCTGGGCCTGTGATGGAAGGGG + Intronic
1188997556 X:36904699-36904721 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1189431454 X:40950759-40950781 CTCTGGGCCTGTGATGGAAGGGG + Intergenic
1189720705 X:43913558-43913580 CTCTGGGGTTGTTAAAGAAACGG - Intergenic
1190240795 X:48656294-48656316 CGATGGGATTGTACTGGAAATGG - Intergenic
1190425297 X:50329596-50329618 CTCTGGGTCTGTGATGGAAGGGG + Intronic
1191735564 X:64384777-64384799 CTCTGGGTCTGTGATGGGAGGGG + Intronic
1192162419 X:68798547-68798569 CTCTGGGTCTGTGATGGGAGAGG - Intergenic
1192689649 X:73349135-73349157 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1193210458 X:78801659-78801681 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1193316566 X:80071982-80072004 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1193585627 X:83318400-83318422 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1193772690 X:85606014-85606036 CTCTGAGTGTGTAATGGGAGGGG + Intergenic
1193930512 X:87546194-87546216 CTCTGGTTCTGTCATGGGAAGGG - Intronic
1194054735 X:89117462-89117484 CTCTGGGCCTGTAAAGGAAGGGG + Intergenic
1194300544 X:92181551-92181573 CTCTGGGCCTGTAATGGGAGGGG - Intronic
1194321076 X:92447311-92447333 CTCTGGGCTTGTGATGGGAGGGG - Intronic
1194377342 X:93152083-93152105 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1194418068 X:93637790-93637812 CTCTAGGTTTATAATGGGAAGGG - Intergenic
1194471734 X:94305094-94305116 CTCTGGGTCTGTGATGGGAGAGG + Intergenic
1194484760 X:94473279-94473301 CTCTGGGTCTGTGATGGGATGGG - Intergenic
1194525215 X:94969452-94969474 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1194864484 X:99048845-99048867 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1195838786 X:109149838-109149860 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1195879121 X:109574526-109574548 CTCTGGGCCTGTGATGGGAAAGG - Intergenic
1196042578 X:111221108-111221130 TTCTGCATTTGTATTGGAAAAGG + Intronic
1196558685 X:117121277-117121299 CTCTGGGAATGTGATGGAAGGGG + Intergenic
1197471553 X:126869385-126869407 CTCTGGGCTTGTGATGGGAGGGG + Intergenic
1197524729 X:127547554-127547576 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1197586379 X:128353325-128353347 CTCTCGGTTTGTAATGGCAGGGG - Intergenic
1198708119 X:139471771-139471793 CTCTGGGCTTCAGATGGAAAGGG - Intergenic
1198817491 X:140608296-140608318 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1198941945 X:141965845-141965867 CTCTGGGCCTGTGATGGAAGAGG - Intergenic
1198943804 X:141987369-141987391 CTCTGGGCTTGTGATGGGAGGGG - Intergenic
1198991598 X:142520794-142520816 CTCTGGGTCTGTGATGGGAGGGG + Intergenic
1198996323 X:142578156-142578178 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1199078559 X:143551441-143551463 CTCTGGGCCTGTAATGGGAGGGG - Intergenic
1199083661 X:143605727-143605749 CTCTGGGCTTATAATGGCAGGGG - Intergenic
1199112772 X:143955086-143955108 CTCTGGGCCTGTTATGGAAGGGG - Intergenic
1199139178 X:144289878-144289900 CTCTGGGTCTGTGATGGGAGGGG - Intergenic
1199329596 X:146543197-146543219 CTCTGGGCTTATGATGGGAAGGG + Intergenic
1199350462 X:146794778-146794800 CTCTGGGCCTGTGATGGAAGGGG - Intergenic
1199374189 X:147088090-147088112 CTCTGCGTTTGGAAAGGAGATGG - Intergenic
1199908805 X:152262206-152262228 CTCTGGGCCTGTGATGGAAGGGG + Intronic
1199931890 X:152531182-152531204 CTCTGGGCCTGTGATGGGAAGGG + Intergenic
1200445866 Y:3259658-3259680 CTCTGGGCCTGTGATGGAAGTGG - Intergenic
1200629194 Y:5560458-5560480 CTCTGGGCTTGTGATGGGAGGGG - Intronic
1200685679 Y:6256129-6256151 GTCTAGGTATGTAATGGAATTGG - Intergenic
1200836134 Y:7733476-7733498 CACTAGGTATGTAAAGGAAAAGG + Intergenic
1200991210 Y:9347371-9347393 GTCTAGGTATGTAATGGAATTGG - Intergenic
1200993868 Y:9367663-9367685 GTCTAGGTATGTAATGGAATTGG - Intronic
1200996531 Y:9387982-9388004 GTCTAGGTATGTAATGGAATTGG - Intergenic
1200999046 Y:9456536-9456558 GTCTAGGTATGTAATGGAATTGG - Intergenic
1201001699 Y:9476845-9476867 GTCTAGGTATGTAATGGAATTGG - Intronic
1201004366 Y:9497147-9497169 GTCTAGGTATGTAATGGAATTGG - Intergenic
1201007019 Y:9517459-9517481 GTCTAGGTATGTAATGGAATTGG - Intergenic
1201469431 Y:14317630-14317652 CTCTTGGCTTGTGATGGAAGGGG - Intergenic