ID: 1116639199

View in Genome Browser
Species Human (GRCh38)
Location 14:47439536-47439558
Sequence CTGAATCACCACAAGCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116639199 Original CRISPR CTGAATCACCACAAGCATAG AGG (reversed) Intronic
900118294 1:1037941-1037963 CTGAGTCTCCACAGGCCTAGGGG - Intronic
905130742 1:35755178-35755200 CTCAATCTCCCCAAGCTTAGAGG + Intronic
906809330 1:48810192-48810214 CAGAAGCACCTCAAGCACAGGGG - Intronic
907603105 1:55789631-55789653 CTGAATCACCAAAAGCAAGTTGG - Intergenic
908203698 1:61823434-61823456 CTGAATGACCTCAGGCATACTGG + Intronic
908680572 1:66656484-66656506 CAGCATCACCACAAGCACATGGG + Intronic
909273327 1:73652477-73652499 CTGAATCACCAATAGCATTTTGG + Intergenic
910908941 1:92213813-92213835 CTCAAAAACCAAAAGCATAGAGG + Intergenic
913582324 1:120238508-120238530 CCAAATCACCACAAACTTAGTGG + Intergenic
913600357 1:120415769-120415791 CTGAATCACCTCATGACTAGCGG + Intergenic
913625849 1:120659875-120659897 CCAAATCACCACAAACTTAGTGG - Intergenic
913994689 1:143642699-143642721 CTGAATCACCTCATGACTAGCGG - Intergenic
914086697 1:144460874-144460896 CTGAATCACCTCATGACTAGCGG - Intronic
914192591 1:145424811-145424833 CTGAATCACCTCATGACTAGCGG - Intergenic
914361512 1:146939492-146939514 CTGAATCACCTCATGACTAGCGG + Intronic
914564259 1:148849983-148850005 CCAAATCACCACAAACTTAGTGG + Intronic
914590503 1:149102760-149102782 CTGAATCACCTCATGACTAGCGG - Intronic
914608567 1:149280256-149280278 CCAAATCACCACAAACTTAGTGG - Intergenic
918534747 1:185561492-185561514 CTGAATCCCCTCAAACTTAGTGG + Intergenic
920593491 1:207245399-207245421 CAGAATCAGTACAAGCAAAGAGG - Intergenic
920650442 1:207833463-207833485 CTAAATCACCATAAGGGTAGAGG + Intergenic
920656170 1:207876923-207876945 CTGGGTCACCACAATCATAAGGG + Intergenic
922087509 1:222364943-222364965 CTCTATCACCACAACAATAGAGG - Intergenic
923065019 1:230509654-230509676 CTGAATCACCACATCCAGACAGG - Intergenic
923397074 1:233576786-233576808 ACAAATTACCACAAGCATAGTGG + Intergenic
1063738415 10:8789562-8789584 CTGAAACACCATGAGGATAGAGG + Intergenic
1064093283 10:12403425-12403447 CTGAATCCTCACAAGTAAAGTGG - Intronic
1065638727 10:27758023-27758045 TTGAATCACCTTAAGCATTGGGG + Intergenic
1068147625 10:53091185-53091207 ATAAATCACCACAAGCTTAGTGG + Intergenic
1068375159 10:56168599-56168621 ATAAATTACCACAAGCTTAGTGG + Intergenic
1069298552 10:66877730-66877752 CTAAATCAAGACAAGAATAGAGG - Intronic
1074876692 10:117619103-117619125 ATCAATCACCACAAACATGGTGG - Intergenic
1074930478 10:118120302-118120324 CTGAAGCACCACAAACTTAAGGG + Intergenic
1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG + Intergenic
1078880015 11:15438720-15438742 CTGAATCAACACAAAAAAAGTGG - Intergenic
1078955137 11:16185283-16185305 TTGAATATCCACAAGCAGAGTGG - Intronic
1080824940 11:35840124-35840146 ATGAATTACCATAAACATAGTGG + Intergenic
1081240115 11:40695167-40695189 CCTGATCACCACAAGCATAATGG - Intronic
1081340786 11:41924591-41924613 CTAAGCCACCACAAGCATGGTGG + Intergenic
1081661600 11:44891928-44891950 GTGAATTACCACAAGAATAGTGG + Intronic
1082639982 11:55647432-55647454 ATGAATTACCACAAACTTAGTGG - Intergenic
1082766766 11:57174993-57175015 GCAAATCACCACAAACATAGTGG + Intergenic
1086997353 11:93373159-93373181 CTGGATGACCCCAAGCCTAGAGG - Intronic
1088416941 11:109599731-109599753 CTGAAGAAACACAAGCATAAAGG - Intergenic
1089082365 11:115787510-115787532 CTGAGTCATGACAAGCAGAGAGG - Intergenic
1093751250 12:22803024-22803046 AACAATTACCACAAGCATAGTGG + Intergenic
1094306955 12:29031088-29031110 CAGAATGAACAAAAGCATAGAGG + Intergenic
1095971348 12:47904066-47904088 CTCACTCACCGCACGCATAGAGG + Intronic
1098745515 12:74232791-74232813 CTCAACCACCAAAAGCAAAGTGG + Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1101229483 12:102725321-102725343 CTGAATTGCCACAAACTTAGTGG - Intergenic
1101843650 12:108344931-108344953 ATAAATCACCACAAACTTAGTGG - Intergenic
1103471049 12:121181534-121181556 CTGAATTACCACAAACTAAGTGG + Intronic
1103875714 12:124125679-124125701 ATAAATCACCACAAGCTTAGTGG + Intronic
1103944773 12:124519951-124519973 CTGAATTACCACGTGGATAGCGG - Intronic
1103963894 12:124626067-124626089 ACAAATCACCACAAACATAGAGG - Intergenic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1111542809 13:89690179-89690201 CTGAATCAGCACAGTCCTAGTGG + Intergenic
1111784603 13:92771030-92771052 CTGACTCTCCACAAGCCTAGTGG + Intronic
1112058564 13:95714669-95714691 TTGAATCACCAGAAAAATAGTGG - Intronic
1112191833 13:97185788-97185810 ATGAATTAACACAAGCCTAGTGG - Intergenic
1112288666 13:98125934-98125956 ACGAATCACCACAGGCTTAGAGG - Intergenic
1113866053 13:113525310-113525332 CAGCATCACCACAAGCATGGGGG - Intronic
1115381512 14:32745591-32745613 CTGAACCAGCACAGTCATAGTGG - Intronic
1115570134 14:34658540-34658562 CTGAATTACCACAAACTTAATGG - Intergenic
1116639199 14:47439536-47439558 CTGAATCACCACAAGCATAGAGG - Intronic
1117516451 14:56506915-56506937 ATGAATTACCACAAACTTAGTGG + Intronic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1120509514 14:85396538-85396560 ATGAAAGACCACAAGCACAGTGG + Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1122394132 14:101410772-101410794 CTGAATAAGGACAAGCATTGAGG + Intergenic
1125730485 15:41890257-41890279 CTCAGTCACCAAAAGCTTAGGGG + Intronic
1125746942 15:42003751-42003773 CGGGCTCATCACAAGCATAGGGG + Intronic
1127732473 15:61813569-61813591 CCGAGTCACCAGAAGCACAGAGG - Intergenic
1135879650 16:26241394-26241416 CTGACTCAGCACAGTCATAGTGG + Intergenic
1135981598 16:27151994-27152016 GTGAACCACCCAAAGCATAGTGG + Intergenic
1137330832 16:47493658-47493680 CTGAATGACCAGAAACCTAGTGG + Intronic
1137640652 16:50025526-50025548 CTGAGTCCCCACAAACCTAGAGG + Intronic
1140358574 16:74325969-74325991 CTGAATAAACTCCAGCATAGAGG - Intergenic
1140704445 16:77613565-77613587 ACAAATCACCACAAACATAGTGG + Intergenic
1140882199 16:79209087-79209109 GTAAATCACCCCAAGCCTAGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141604399 16:85144668-85144690 ACAAATCACCACAAGCTTAGAGG + Intergenic
1143465505 17:7133820-7133842 CTGCCTCATCACAAGCACAGAGG + Intergenic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1145966842 17:28925213-28925235 CTGAGTCACCACAAGGTCAGAGG - Intronic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1148897107 17:50845410-50845432 CTGGATCAGCACAAACACAGAGG - Intergenic
1150867634 17:68870387-68870409 CGGAATCACCCCAAACACAGTGG - Intronic
1152475622 17:80516235-80516257 CTGAATCACCACAGGCCTCATGG + Intergenic
1153321752 18:3780274-3780296 ATAAATCACCACAAGCTTAGTGG + Intronic
1154400417 18:14031751-14031773 CTGAATGACCAGAAACCTAGCGG + Intergenic
1155605512 18:27601314-27601336 ATGAATTACCACAAACTTAGTGG + Intergenic
1156406115 18:36784183-36784205 AGGAATCACCACAAGCTTGGTGG - Intronic
1159030445 18:63225569-63225591 CTTCATCACCACAAACATTGTGG - Intronic
1159333705 18:67035541-67035563 CCAAATTACCACAAGCTTAGTGG - Intergenic
1159367015 18:67479962-67479984 ATGATTCACCATAAGCATATGGG - Intergenic
1161477754 19:4495844-4495866 CTGAATCTCCACAAGGGTAGAGG - Intronic
1163179095 19:15585930-15585952 CTTGGTCACCACAAGCCTAGAGG - Intergenic
1165733695 19:38162726-38162748 CTGAATCACCACGTGAATGGCGG - Intronic
1167490460 19:49790047-49790069 ATGAATTACCACCAGCACAGCGG + Intronic
1168180903 19:54662577-54662599 ACAAATCACCACAAGCTTAGTGG - Intronic
925292320 2:2756015-2756037 CTGCATCACCCCAACCAGAGAGG + Intergenic
926640567 2:15231238-15231260 CTGAAGAACCATAAGCAAAGGGG + Intronic
928070557 2:28210793-28210815 ATGAATCTCCAAAAGAATAGTGG + Intronic
931161848 2:59701782-59701804 CTGAACCAGCACAGTCATAGTGG - Intergenic
931511285 2:62998260-62998282 CTGAATCCACACAAGTATATAGG - Intronic
933114228 2:78446736-78446758 CTGTATGACCACAGGCTTAGGGG - Intergenic
933162955 2:79045734-79045756 CTGACCCAGCACAATCATAGTGG + Intergenic
933317120 2:80728091-80728113 CTGACCCACCACAGTCATAGTGG + Intergenic
937649406 2:124303188-124303210 CTGAATCATTACCAGCATATGGG + Intronic
937653466 2:124347147-124347169 CTAAATTACCATAAACATAGTGG - Intronic
938277402 2:130038318-130038340 CTCCACCACCACAAGCACAGGGG + Intergenic
938328374 2:130429121-130429143 CTCCACCACCACAAGCACAGGGG + Intergenic
938361574 2:130692373-130692395 CTCCACCACCACAAGCACAGGGG - Intergenic
938437982 2:131299062-131299084 CTCCACCACCACAAGCACAGGGG - Intronic
938717891 2:134037441-134037463 ATGAATCACCACAAACTTAGTGG + Intergenic
939479924 2:142734981-142735003 CTGACTCACCAGAAGTACAGAGG + Intergenic
940513379 2:154647999-154648021 ATGAATTACCACAAATATAGTGG - Intergenic
942806209 2:179934039-179934061 CTGAATCAGGTCAAGCACAGTGG + Intergenic
944040109 2:195343886-195343908 ATAAATTACCACAAGCATAGTGG + Intergenic
944892649 2:204133768-204133790 CTGAGTTACCAAAAGCATTGTGG - Intergenic
946055070 2:216893938-216893960 ACAAATCACCACAAACATAGTGG - Intergenic
946568729 2:220997683-220997705 CTGAATAAAAACAAGCATATGGG - Intergenic
947129276 2:226904751-226904773 CTGAAACACCACAAGCAAGATGG - Intronic
947326304 2:228982035-228982057 CGGGATCACTACAAGCATGGTGG - Intronic
1169401167 20:5282010-5282032 ACAAATCACCACAAGCTTAGTGG + Intergenic
1182216256 22:28720751-28720773 ATGAATAGCTACAAGCATAGAGG - Intronic
1183278709 22:36919946-36919968 CTGAATCACTATTGGCATAGAGG + Intronic
1183295797 22:37028803-37028825 CTGAATAATTACAAGCATAATGG - Intronic
951864812 3:27296043-27296065 CTTAATTACCACAACCATAAAGG + Intronic
952520840 3:34155736-34155758 ATGAAGCACCACAAACTTAGTGG - Intergenic
952762870 3:36930504-36930526 ATGAATGACCACAAACTTAGTGG - Intronic
963067055 3:141272247-141272269 CTGAAACTCAACAACCATAGGGG - Intronic
963467802 3:145704454-145704476 AGAAATCACCACAAACATAGTGG - Intergenic
964450540 3:156808493-156808515 CTGAATCACCACAAAGTTAATGG - Intergenic
964904381 3:161701142-161701164 CTGACTCAGCACAGTCATAGTGG + Intergenic
970938749 4:21606411-21606433 CCGAATTACCACAAACTTAGTGG + Intronic
971605693 4:28654207-28654229 ATAAATTACCACAAACATAGTGG + Intergenic
972869153 4:43274580-43274602 GTGAATAACCACAACCATAATGG + Intergenic
975832795 4:78387593-78387615 CTGAACCATCATGAGCATAGTGG - Exonic
976762469 4:88564978-88565000 CTGAATGACCAGAAGCATATTGG - Intronic
978116587 4:105025865-105025887 CTGATTCAGCACAGTCATAGTGG + Intergenic
978134471 4:105240588-105240610 CTTAATAACCACACGCAAAGAGG - Intronic
978265987 4:106824469-106824491 CGGAATCACCAAAAGCAAAGGGG + Intergenic
980103839 4:128567914-128567936 ACAAATCACCACAAACATAGTGG + Intergenic
981308702 4:143273979-143274001 CTGATTCAGCAAAACCATAGTGG + Intergenic
981870963 4:149486131-149486153 CTGACTCAGCACAGTCATAGTGG - Intergenic
984035791 4:174665933-174665955 CTTAATCCCCACAACAATAGAGG + Intronic
990053126 5:51533193-51533215 CAGCATCACCACAAGCATGTGGG - Intergenic
991419694 5:66428453-66428475 ATGAATTACCACAAACTTAGCGG - Intergenic
998716508 5:144890144-144890166 CTGACTCAGCACAATCATAGTGG + Intergenic
1000660391 5:163931354-163931376 ATGAATTACCACAAACTTAGTGG - Intergenic
1002366966 5:178720673-178720695 CTGAAGTACCACAAGCTTCGTGG - Intronic
1004861772 6:19811215-19811237 ATGAATCACTAAAAACATAGGGG + Intergenic
1006946047 6:37785141-37785163 CTGAATAACCACCAGGAGAGAGG + Intergenic
1008312264 6:49990435-49990457 CTGAACCAGCACAGTCATAGTGG + Intergenic
1008568440 6:52792085-52792107 CTCCATCAGCACAAGCATGGAGG + Intronic
1011733198 6:90287266-90287288 TTGACATACCACAAGCATAGTGG - Intronic
1014559747 6:122875444-122875466 ATGAATTACCACAAACTTAGCGG + Intergenic
1018427172 6:163694004-163694026 CTGAAGCACCACTAGGATAGAGG + Intergenic
1018784166 6:167095005-167095027 CTGACTAACCACAAGCCCAGAGG - Intergenic
1022536088 7:31099533-31099555 CAGAATCAGCACATACATAGGGG - Intronic
1027622953 7:80514924-80514946 CTGAAATACCACAAGTATGGAGG + Intronic
1029378202 7:100195071-100195093 CCGAATAACCACATGCAGAGGGG + Intronic
1036949352 8:13126148-13126170 CTGGATCCGCACAAGCCTAGAGG - Intronic
1038461414 8:27720485-27720507 CTGAAGCCCCACATGCATAGTGG - Intergenic
1041406006 8:57500366-57500388 AAGACCCACCACAAGCATAGGGG + Intergenic
1042357242 8:67841645-67841667 CTGCTTCACCAGAAGAATAGAGG + Intergenic
1044826980 8:96208094-96208116 CCAAATTACCACAAGCATAGAGG + Intergenic
1045101965 8:98853654-98853676 ATGAATCAGCACTAGCATTGTGG - Intronic
1045606437 8:103782929-103782951 ATGAATGACCACAAACTTAGAGG + Intronic
1047683033 8:127274506-127274528 ATAAATAACCACAAGCATAGTGG - Intergenic
1051838272 9:21365013-21365035 CTTCATCACCACAACTATAGGGG + Intergenic
1055900210 9:81225390-81225412 CTGAATATCTACAACCATAGTGG + Intergenic
1058767903 9:108199421-108199443 CTGACCCAGCACAATCATAGTGG + Intergenic
1058921246 9:109617281-109617303 GTAAATCACCACAAGATTAGTGG + Intergenic
1187592532 X:20734111-20734133 ATGAATTACCACAAACTTAGTGG + Intergenic
1188815217 X:34705057-34705079 CTGACCCAGCACAATCATAGTGG - Intergenic
1188972277 X:36632650-36632672 TAGAATCACCACTAGCATATTGG - Intergenic
1188984926 X:36760685-36760707 CTGAAGCACAGCAAGCCTAGGGG - Intergenic
1191910216 X:66142494-66142516 CTGAACCACAGCAAGCATAATGG - Intergenic
1192357649 X:70419171-70419193 CTGAAAAACCACAGGAATAGAGG - Intronic
1192495428 X:71613827-71613849 ACAAATTACCACAAGCATAGTGG + Intergenic
1193301984 X:79900125-79900147 CTGATTCACCACAAGCAAGTAGG + Intergenic
1193697163 X:84723499-84723521 CTGAACCAGCACAATCATAGTGG - Intergenic
1194861879 X:99009526-99009548 CTGAATCATCACAACCCTTGAGG - Intergenic
1196466281 X:115974074-115974096 CTGATCCAGCACAATCATAGTGG + Intergenic
1197307764 X:124863824-124863846 CTGAAACAGCACAGTCATAGTGG + Intronic
1197458434 X:126707368-126707390 CTGACTCAGCACAGTCATAGTGG + Intergenic
1197582741 X:128304575-128304597 CTTAATCACCTCCAGTATAGTGG - Intergenic
1199163809 X:144647147-144647169 CTGAGCCAGCACAATCATAGTGG - Intergenic
1199421265 X:147647514-147647536 CTGAAAAACCACAAGCACAATGG + Intergenic