ID: 1116647169

View in Genome Browser
Species Human (GRCh38)
Location 14:47543201-47543223
Sequence CTGCTGTTGTCGCTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116647169_1116647173 13 Left 1116647169 14:47543201-47543223 CCCTGTCCCAGCGACAACAGCAG 0: 1
1: 1
2: 1
3: 11
4: 224
Right 1116647173 14:47543237-47543259 ATAAAAGTATTTTATCTTTTAGG 0: 1
1: 0
2: 14
3: 128
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116647169 Original CRISPR CTGCTGTTGTCGCTGGGACA GGG (reversed) Intronic
901168815 1:7239562-7239584 CTGCAGAGGGCGCTGGGACATGG - Intronic
902798061 1:18812283-18812305 CTGCTGTTGTCAGTGAGCCAAGG - Intergenic
902984453 1:20147144-20147166 CTGCTGCTGTTGCTGGTTCAGGG - Intronic
903759367 1:25687103-25687125 CTGCTGTTGTCGTTTTGAAATGG - Intronic
903857225 1:26344470-26344492 CTCCTGTTGGCACTGGGGCAGGG + Exonic
904407624 1:30303467-30303489 CTGCTGCTGTCTCTGGCAGAAGG + Intergenic
904919860 1:33998663-33998685 CTGGTGTTGTGTCTGGTACATGG + Intronic
911584530 1:99675447-99675469 CTACTGTTGTGGCCAGGACATGG - Intronic
913168213 1:116208945-116208967 CTGCTGATGTCCCTGGGATCTGG + Intergenic
913562623 1:120037338-120037360 CTGCTGTTGATTCTGGCACATGG + Intronic
913635499 1:120756269-120756291 CTGCTGTTGATTCTGGCACATGG - Intergenic
914283220 1:146196719-146196741 CTGCTGTTGATTCTGGCACATGG + Intronic
914544250 1:148647439-148647461 CTGCTGTTGATTCTGGCACATGG + Intronic
914622384 1:149423573-149423595 CTGCTGTTGATTCTGGCACATGG - Intergenic
914701945 1:150142669-150142691 CTGTTGTTGTTGTTGAGACAGGG + Intronic
917091383 1:171356933-171356955 TTGTTGTTGTTGTTGGGACAGGG - Intergenic
917138178 1:171808009-171808031 CTTCTGTGGTCGTTGGGAGAAGG - Intronic
918294469 1:183143137-183143159 CTGCTGGTATCGATGAGACAGGG - Exonic
920320018 1:205113114-205113136 TTGTTGTTGTTGCTGAGACAGGG - Intronic
920924515 1:210329005-210329027 CCGCCGATGTCGCTGGGACTCGG + Exonic
921629381 1:217415191-217415213 CTGATATTATGGCTGGGACATGG + Intergenic
922481768 1:225944335-225944357 CTCCTGTTCTCTCTGTGACAAGG + Intergenic
1063666173 10:8061960-8061982 CTGCAGTCCTAGCTGGGACAGGG + Intronic
1070014087 10:72507650-72507672 CTGCTGTTGTTTTTGAGACAGGG + Intronic
1072717820 10:97763130-97763152 CTGCTGTCTGGGCTGGGACATGG + Intergenic
1074450266 10:113553724-113553746 CTGCTGCTGTCACAGGGAAAAGG - Intronic
1074536910 10:114334647-114334669 CTGCTGCAGTCCCTGGCACAGGG - Intronic
1074543308 10:114384092-114384114 CTGCAGTTGTCACTGGATCATGG - Intronic
1075591147 10:123692570-123692592 CTGGTGTTGGCTCTGGGACCTGG + Exonic
1077800714 11:5533284-5533306 TTCCTGTTGCTGCTGGGACAGGG + Intronic
1080344164 11:31303844-31303866 CGACAGTTGTTGCTGGGACACGG - Intronic
1081722209 11:45298643-45298665 CTGCTGGTGTGGATGGGCCATGG + Intergenic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1083849056 11:65354882-65354904 CTGCTGTCGCCGCCCGGACAGGG + Exonic
1083880709 11:65546972-65546994 CTGCTGTGGACGCTGGGAGCCGG - Intronic
1084389454 11:68865609-68865631 CTGCTGGTGTTGCTGTGACAAGG - Intergenic
1084663496 11:70561533-70561555 TTGTTGTTGTTGCTGAGACAGGG + Intronic
1088824785 11:113484367-113484389 CTGCTGATGTCCCTGAGGCAGGG - Intergenic
1089465044 11:118679572-118679594 CTGCTGCTGGGGCTGGGACTGGG - Exonic
1094720911 12:33063158-33063180 GGGCTGTTGCTGCTGGGACAGGG + Intergenic
1096075470 12:48801148-48801170 CTGCTGTTGTCCCCGGAGCATGG - Intergenic
1097061656 12:56289355-56289377 CTGATGTAGTCTCTGGGACATGG - Intronic
1098028973 12:66235163-66235185 CTGCTGGTGGTGCTGGGACTGGG + Intronic
1098701400 12:73632402-73632424 ATGCTGTTGTTGCTGGTCCAGGG - Intergenic
1098955834 12:76688989-76689011 TTGTTGTTGTAGCTGAGACAGGG + Intergenic
1099668427 12:85659993-85660015 CGGCTGGAGTGGCTGGGACATGG - Intergenic
1101982751 12:109421830-109421852 CTGCTGTTGTTTTTGAGACAGGG + Intronic
1103409122 12:120698352-120698374 CTGTTGTTTTCGCTGTGACTTGG + Exonic
1103618496 12:122170978-122171000 CTGCTGCTGCTGCTGGGCCAGGG + Intronic
1105894536 13:24707024-24707046 ATGCTGTTGTTGCTGTGACCGGG + Exonic
1106063221 13:26316351-26316373 CTGTTGTTGTTGTTGCGACAGGG - Intronic
1109623468 13:64941802-64941824 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1110305672 13:73984342-73984364 CTGCTCTCCTCGCTGGCACAGGG + Intronic
1111059243 13:82990654-82990676 CTGTTGTTGTTGTTGAGACAGGG - Intergenic
1112404231 13:99103862-99103884 CTGATGTTGTCCGTGTGACACGG + Intergenic
1112638641 13:101246175-101246197 CTGCTGTTGTTACTGGTAGAGGG - Intronic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1113913550 13:113856309-113856331 CTCCTGTGCTCGCTGGGACTGGG - Intronic
1114968819 14:28000825-28000847 CTGCTGTTGTGGCTTGGAGGAGG - Intergenic
1115715118 14:36094924-36094946 CTGCAGTTGCTGCTGGGGCAAGG + Intergenic
1116647169 14:47543201-47543223 CTGCTGTTGTCGCTGGGACAGGG - Intronic
1119767824 14:77201550-77201572 ATGCTGATGCCGCTGGGCCAGGG - Intronic
1132069972 15:98767803-98767825 CTGCTGGTGCCGGTAGGACAGGG + Intronic
1134298097 16:12964594-12964616 CTGATGTTGTGGCTTGGTCAAGG + Intronic
1135109818 16:19681853-19681875 CTGCTTTTGTGGTTGGAACAGGG + Intronic
1136129813 16:28212377-28212399 CTGCTGTGGATGCTAGGACAGGG + Intergenic
1136683266 16:31980020-31980042 CTGCTGTAGGCCCTGGGATATGG + Intergenic
1136783899 16:32923576-32923598 CTGCTGTAGGCCCTGGGATATGG + Intergenic
1136885884 16:33930230-33930252 CTGCTGTAGGCCCTGGGATATGG - Intergenic
1136996792 16:35196091-35196113 CTGCTGGTGCCGCTCGGGCAGGG - Intergenic
1137396162 16:48117410-48117432 CTGCTGGTGTTGCTGGGGCAAGG + Intronic
1137532094 16:49284232-49284254 CAGCTGTTGTCAGTGGGAAAGGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139901831 16:70334133-70334155 CTGCTGTGGGCACTAGGACAGGG - Exonic
1141594327 16:85088194-85088216 CTGCTCTTGTCACTCGGACAGGG - Intronic
1142329382 16:89441415-89441437 CTGCTTTTGTTGCTGGGTGATGG - Intronic
1203086557 16_KI270728v1_random:1187578-1187600 CTGCTGTAGGCCCTGGGATATGG + Intergenic
1144018701 17:11221290-11221312 CTGCTTTTGTGGCTGGGCAAGGG + Intergenic
1144735625 17:17553855-17553877 CTCCTGTCGTGGCAGGGACATGG - Intronic
1145206571 17:20987629-20987651 GAGCTGTTGCCCCTGGGACAAGG + Intergenic
1146230710 17:31105862-31105884 CTGCTGGTGGGGGTGGGACACGG - Intronic
1146373808 17:32281237-32281259 CTGCTGTTGTCCTAGTGACATGG - Intronic
1146965807 17:37028775-37028797 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1147144175 17:38475732-38475754 CTGCTGTAGGCCCTGGGATATGG + Intronic
1149516997 17:57288294-57288316 CAGCTGTTGTCGCTGGGACAGGG + Intronic
1149982036 17:61318459-61318481 CTGCTGATGTCACTGGGAGAGGG - Intronic
1151204842 17:72498860-72498882 ATGCTGATGTCGCTGGTCCAAGG + Intergenic
1151440223 17:74123831-74123853 CTGCATTTGTTTCTGGGACAAGG - Intergenic
1151886090 17:76924126-76924148 CAGCTGTGGCTGCTGGGACAGGG + Intronic
1152230810 17:79113140-79113162 CTGCTGATGACCCAGGGACAGGG + Intronic
1152348722 17:79771029-79771051 CTGCTGATGCAGCAGGGACATGG + Intergenic
1152494540 17:80661665-80661687 CTTCTGTTGCTGCTGGGAAAGGG + Intronic
1152513242 17:80804554-80804576 CTGCTGTCCTCCCTGGGACGGGG - Intronic
1152920279 17:83063099-83063121 CTCCTGTTGGGGCAGGGACAGGG + Intergenic
1155392796 18:25352695-25352717 CTGCTGTTGTTGCCCGGACTCGG + Intergenic
1158518062 18:58147206-58147228 CTGGTGTTGGCTCTGGAACAGGG + Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1159648740 18:70952376-70952398 CTCCTTTTGTGGGTGGGACAGGG + Intergenic
1163021472 19:14482960-14482982 CTGCTCATGCCGCTGGGACTGGG - Exonic
1163128412 19:15257046-15257068 CTGCTGCTGTCGCTGGATGAGGG + Exonic
1164758331 19:30707662-30707684 CTACTGTTGTCCCTAAGACAAGG - Intronic
1166068485 19:40374167-40374189 ATGCTGTTGCCGCTGGATCAGGG + Intronic
1166611210 19:44199179-44199201 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
925727609 2:6888903-6888925 TTGCTGTTGTCCCGGGGACACGG - Intronic
928126665 2:28621069-28621091 CTGCTATTGCCCCTGGGACCAGG - Intronic
930357990 2:50345732-50345754 CTGCTGTTTTCAAAGGGACAGGG + Intronic
930526929 2:52542271-52542293 CTGCTGTTGTGGGTGGGGGAAGG - Intergenic
930757896 2:54996765-54996787 TTGTTATTGTCGCTGAGACAAGG + Intronic
931044945 2:58341115-58341137 CTGCTGCTGGTGGTGGGACAAGG - Intergenic
935212249 2:100948009-100948031 GTGCTGTTGTCTGTGGGCCAAGG - Intronic
936650462 2:114420822-114420844 CTTCTGTTATCACAGGGACAGGG - Intergenic
937284215 2:120739655-120739677 CAGCTGTTCCCGCTGGGCCAGGG + Intronic
937601697 2:123744281-123744303 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
937776950 2:125789106-125789128 TTGCTGTTGTTGCTGAGATAGGG - Intergenic
938118839 2:128619973-128619995 CTGCTGTTCTCTCTGGGTCCTGG + Intergenic
938159733 2:128974295-128974317 CTCCTTTTGTCACTGGGGCAGGG - Intergenic
939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG + Intergenic
940450401 2:153828520-153828542 CGGCTGGAGTGGCTGGGACACGG + Intergenic
941016839 2:160367336-160367358 CTGCTGGTGGTGCTGGGACTGGG + Exonic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
944658979 2:201904674-201904696 ATGCTGATGTTGCTGGTACAGGG - Intergenic
945131230 2:206574934-206574956 CTGCTGTAAATGCTGGGACATGG + Intronic
945901778 2:215546324-215546346 CTGCTGATGCCGCTAGTACAGGG + Intergenic
946954998 2:224920077-224920099 TTGCTGTTGTTGTTGAGACAGGG + Intronic
947348284 2:229216497-229216519 CTGCTCTTTTCTCTGAGACATGG - Intronic
948734829 2:239995306-239995328 CTCCTGCTGTCACTGTGACATGG - Intronic
1171431792 20:25087608-25087630 CTCCTTTTGTCCCTGGGTCAAGG - Intergenic
1172976818 20:38912329-38912351 ATGCTGATGTTGCTGGTACAGGG - Intronic
1174082743 20:47982780-47982802 CTGCTCTGGGTGCTGGGACAGGG + Intergenic
1175487253 20:59355211-59355233 CGGATGTTATCGCTGGGACTTGG + Intergenic
1175883550 20:62274506-62274528 CAGCTGCTGTCTCTGTGACAGGG + Intronic
1178451555 21:32705978-32706000 TTGCTGTTGTTGTTGAGACAGGG - Intronic
1180188823 21:46153206-46153228 CTGGTGCTGCCGCTGGGGCAGGG - Intronic
1180904715 22:19401300-19401322 TTGTTGTTGTTGCTGAGACAGGG + Intronic
1181497018 22:23293016-23293038 CTGCTGGTGGGGCTGGGACAGGG + Intronic
1182041248 22:27240343-27240365 CTGCTTCTATCGCTGGGGCAGGG - Intergenic
1182155542 22:28068998-28069020 CTGCTGATGTCAGTGGGACTGGG + Intronic
1184606750 22:45578730-45578752 CTGCAGTTGTGGCTGGGACATGG + Intronic
1184959084 22:47915821-47915843 CGACTGTTGTGGCTGGCACATGG - Intergenic
1185346304 22:50312304-50312326 AGGCTGGTGGCGCTGGGACAAGG + Intronic
951256246 3:20452883-20452905 CTGCTGAGGTCACTGGGACTCGG - Intergenic
953389760 3:42527376-42527398 CTGCTGCTGTTGGAGGGACAGGG - Exonic
953418846 3:42739459-42739481 CTGCTCCTGTCCCTGGGGCAGGG + Intronic
954716791 3:52530973-52530995 CTGGGGTTGTGGCTGAGACAGGG - Intronic
954785321 3:53088330-53088352 TTGATGTTGTAGCTGGGACTGGG - Intronic
954944390 3:54406816-54406838 CTGCTTTTGTCACTGGGAAGGGG + Intronic
955875533 3:63486402-63486424 CTGCTGGTGCCTCTGGGAAATGG - Intronic
957616719 3:82538433-82538455 CTGCTGTTGTCCTTAGGCCATGG + Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
961785840 3:129346164-129346186 CAGTGGTTGTCGCTGGGCCAGGG - Intergenic
961882866 3:130075135-130075157 CAGGAGTTGTCGCTGGGAGACGG - Intergenic
963072854 3:141319179-141319201 CAGCTGGAGTGGCTGGGACACGG + Intergenic
963373300 3:144430003-144430025 CTGCTGTCATCACTGGGACTTGG + Intergenic
965910422 3:173768776-173768798 TTGTTGTTGTTGCTGAGACAGGG + Intronic
966731337 3:183153852-183153874 CTGCCGTTGTTCCTGGGGCATGG + Exonic
967958735 3:194901211-194901233 CTGGTGTTGTTGGTGGGGCATGG - Intergenic
969064026 4:4462853-4462875 CTGCCCTTGTAGCTGGGAAAGGG + Intronic
970901880 4:21169165-21169187 TTGTTGTTGTTGCTGAGACAGGG + Intronic
976085470 4:81403090-81403112 CTGCGGTGGTGGCTGGGACATGG + Intergenic
979693098 4:123581424-123581446 CTGCTGGTTTACCTGGGACATGG + Intergenic
982100167 4:151959576-151959598 CTGCTGATATGGCAGGGACAAGG - Intergenic
982317911 4:154049935-154049957 CTGCTCTTGTTGCCGGGACCTGG + Intergenic
983316072 4:166134335-166134357 CTGCTGTTGTCAGGGGGACTGGG - Intergenic
990376530 5:55176418-55176440 CTGCCGTTGGCGCTGGGAATGGG - Intergenic
994069214 5:95579582-95579604 CTGCTGATGTTGCTGGTCCATGG + Intronic
994533117 5:100992064-100992086 ATGCTGTAGTTCCTGGGACAAGG - Intergenic
995764642 5:115602232-115602254 CTGCTGTGGTCGCGGGGACTGGG - Exonic
998167187 5:139850915-139850937 CTTCTGTTCCTGCTGGGACATGG + Intronic
998486998 5:142511649-142511671 CTGCTGTTGTCACAGCAACAGGG - Intergenic
1002024661 5:176388801-176388823 CTGCTGCTGTGGCCCGGACATGG + Exonic
1002590318 5:180286725-180286747 CTTCTGCTGTCGCTGGTCCAAGG - Intronic
1002902088 6:1417660-1417682 ATGCAGTTGGAGCTGGGACATGG - Intergenic
1003311701 6:4974562-4974584 CTGCTGGTCTGGCTGAGACAGGG + Intergenic
1003645550 6:7910691-7910713 CTGCTGCTGCTGCTGGGCCATGG - Exonic
1003659279 6:8045155-8045177 CTGCTGGAGTGGCTGGGACATGG - Intronic
1003665800 6:8110145-8110167 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1003682492 6:8269698-8269720 CTGCTGTCATTGCTGGGAAAAGG + Intergenic
1004392863 6:15223921-15223943 TTTCTGTTGTCTCGGGGACAGGG - Intergenic
1004615225 6:17282131-17282153 CTGGTGTTTTGGCTGGGGCAGGG + Intronic
1005096760 6:22124765-22124787 TTGTTGTTGTCGTTGAGACAGGG + Intergenic
1005563339 6:27063979-27064001 CTGCTCTGGTCGCTGGGAGGGGG + Intergenic
1006671282 6:35731415-35731437 CTGCTGGTGGCTCTGGGACGGGG - Intergenic
1008525425 6:52402902-52402924 CTGCTGTTGTTGTAGAGACAGGG - Intronic
1012998958 6:106002361-106002383 TTGTTGATGTTGCTGGGACATGG + Intergenic
1014007513 6:116436852-116436874 CTGCTGCTGTTGCTGTGATATGG - Exonic
1014996601 6:128153336-128153358 GTGCTGCAGCCGCTGGGACATGG + Intronic
1015507384 6:134003266-134003288 CTGCTTTTCTAGCTGGCACAGGG + Intronic
1015739821 6:136442004-136442026 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1018700514 6:166422518-166422540 CTGATGTTGCCAATGGGACAGGG - Intronic
1022030289 7:26486557-26486579 CTGCTGTTCTCCCAGGGCCATGG - Intergenic
1022623312 7:32007422-32007444 CTGCTCTTGTGGCTGGGATCAGG + Intronic
1023359966 7:39405894-39405916 TTGCTGTTGTAGCTGATACATGG - Intronic
1024742174 7:52365984-52366006 CTGGTCCTGTTGCTGGGACAGGG - Intergenic
1027233657 7:76285793-76285815 CGGCTGTGGTAGCTGGGACTGGG - Exonic
1029982441 7:104891450-104891472 ATGCTGTTGTCACTGGGAGTGGG - Intronic
1031019454 7:116611571-116611593 TTCCTGTTGCTGCTGGGACAAGG + Intergenic
1031133821 7:117863582-117863604 CTGCTGATGTTGCTGGTCCACGG + Intronic
1031219827 7:118951111-118951133 CAGCTGTCGTCTCTGGGACAGGG - Intergenic
1031522409 7:122782602-122782624 TTGTTGTTGTTGCTGAGACAGGG - Intronic
1032388840 7:131542648-131542670 CTGTTGTCGTCGTTGAGACAGGG - Intronic
1035022477 7:155807703-155807725 CTGCTGCTGCTGGTGGGACATGG + Intronic
1035234773 7:157489170-157489192 CTGCTGGAGTCGCTGGGGGAGGG - Intergenic
1035376749 7:158411521-158411543 CTGCTGTCGTCCCGGGAACAGGG + Intronic
1035604073 8:917586-917608 CTTTTGTTGTTGCTGAGACAGGG + Intergenic
1036605385 8:10301001-10301023 GTGCTGTTAACACTGGGACAAGG - Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1036706409 8:11050142-11050164 GTGCTGTTGTGGCTAGCACACGG + Intronic
1037811740 8:22090416-22090438 CTGCTGTTGACCCAGGGCCAGGG + Intronic
1038120790 8:24612377-24612399 CCGCTGTTGTCATTGGCACATGG - Intergenic
1040696583 8:50007011-50007033 CTGCTGCTGTCTCTGGTAAATGG + Intronic
1046258070 8:111727159-111727181 CTGCTCATATCACTGGGACAGGG - Intergenic
1047195829 8:122720695-122720717 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1047633724 8:126736191-126736213 CTGCTGATGTAGCTGCCACAGGG + Intergenic
1048404562 8:134106745-134106767 CGGCTGGAGTGGCTGGGACATGG - Intergenic
1048726403 8:137390319-137390341 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1049446254 8:142632890-142632912 CTGCTGTGGTTGCGGGGAGAGGG + Intergenic
1051246698 9:15119000-15119022 CTGCTGTTGTCGTTTGGAAGAGG + Intergenic
1051479002 9:17539480-17539502 CTGATGGTGTATCTGGGACAAGG + Intergenic
1052937346 9:34103832-34103854 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1055221752 9:73941853-73941875 CTGCTTTTGCCCCTGGGATATGG - Intergenic
1055687419 9:78791693-78791715 CAGCTCTTTTCACTGGGACAGGG + Intergenic
1061328772 9:129879578-129879600 CTGCTGTTGTCAATGGGCCCGGG - Exonic
1061695758 9:132372270-132372292 CTGCTGTTGTCCCAGCTACATGG + Intergenic
1062203985 9:135325618-135325640 CTGCTGTTGTCTCTGGTCCTTGG + Intergenic
1062362036 9:136192906-136192928 CTGCTGGCGTCGCTGGCAGAGGG - Intergenic
1062537161 9:137026115-137026137 CTGCTCTTGGTGCAGGGACAGGG - Intronic
1062589313 9:137266358-137266380 CGGCTGCTGGCGCTGGGCCAGGG + Exonic
1185778425 X:2824712-2824734 CTGCTCTTCTCTCTGGAACAGGG - Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1190548948 X:51558879-51558901 CTGTTGTGGTCACTGGGACTCGG - Intergenic
1192120022 X:68446779-68446801 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1196129566 X:112140249-112140271 CTGATTTTGAGGCTGGGACAGGG - Intergenic
1196432101 X:115637949-115637971 TTGCTGTTGTTGTTGTGACAGGG + Intronic
1197654063 X:129097347-129097369 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1198529693 X:137539842-137539864 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1198939659 X:141939324-141939346 CTGTTGTGGTCTCTGGGACTTGG + Intergenic