ID: 1116653035

View in Genome Browser
Species Human (GRCh38)
Location 14:47618246-47618268
Sequence ATAGGTCCTCACTACTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116653035 Original CRISPR ATAGGTCCTCACTACTTTAT AGG (reversed) Intronic
909828811 1:80159723-80159745 ATTTGTCATCACAACTTTATAGG - Intergenic
911416353 1:97579789-97579811 ATAGCTGCTTACTACTTTATTGG - Intronic
912632198 1:111255449-111255471 TTAGGTCATCACTACTTACTGGG - Intergenic
914931409 1:151937326-151937348 ATAGGTACTCACTAATTTTGGGG + Intergenic
921804590 1:219439174-219439196 ATTGGGCCTCACTGCTTCATAGG + Intergenic
924304789 1:242676466-242676488 ATAATTCATCACTTCTTTATGGG + Intergenic
924553015 1:245095832-245095854 ATAGGTCCCCATCACTTTAAAGG - Intronic
1063844364 10:10109363-10109385 ATAGGTGCTCACTAAGTAATTGG + Intergenic
1066710694 10:38230604-38230626 CTAGGTCCTCCCTGCTTCATGGG + Intergenic
1070841174 10:79488913-79488935 ATAGGTACTCACTATTTTCCTGG + Intergenic
1074032299 10:109700966-109700988 ATAGATCCTCACTCCTTAATGGG + Intergenic
1074807552 10:117068414-117068436 ATTGGTGCCCACTACTATATTGG - Intronic
1074807625 10:117069290-117069312 ATTGGTGCCCACTACTATATTGG - Intronic
1079910637 11:26305863-26305885 ATAGCTCTTCACTGGTTTATTGG + Intergenic
1080921703 11:36715574-36715596 ATAGCTACTGACTACCTTATTGG - Intergenic
1083111577 11:60414942-60414964 ATAGGTACTTAGTGCTTTATGGG - Intronic
1093516526 12:19993319-19993341 ATATGTCCTTCCTACTTTATAGG + Intergenic
1095243681 12:39892028-39892050 ATAGATCTTCTCTTCTTTATAGG - Intronic
1095760800 12:45833482-45833504 ATGGGTCCTCATTTCTTTGTAGG + Intronic
1097503921 12:60440147-60440169 ATAACTCCTCACTACTTAGTAGG - Intergenic
1097633268 12:62090272-62090294 ATAGCTCATCACTTGTTTATAGG - Intronic
1098295790 12:69002821-69002843 ATAGGTACTCAATACTGTATTGG + Intergenic
1098405825 12:70124690-70124712 ATACGTCCTCACTTATTTGTAGG + Intergenic
1098834135 12:75400313-75400335 ATAGGTTTTCACCACGTTATAGG + Intronic
1109903598 13:68808090-68808112 ATAGATCCTCTCCATTTTATTGG + Intergenic
1113251929 13:108462707-108462729 ATAGGTCCTCTCTTCATAATGGG - Intergenic
1116653035 14:47618246-47618268 ATAGGTCCTCACTACTTTATAGG - Intronic
1117021415 14:51574582-51574604 ACATGTCCTCACTCATTTATGGG + Intronic
1125974662 15:43940302-43940324 ATAGGGCCCCATTACTTTCTTGG - Intronic
1140822054 16:78671607-78671629 ATAGGGAATCTCTACTTTATAGG - Intronic
1142364375 16:89642166-89642188 ATAGGTCTTCATTATTTTTTGGG - Intergenic
1143859773 17:9880393-9880415 ACTGGTCCTCATTCCTTTATTGG + Exonic
1145789809 17:27619324-27619346 AAAGGTTCTGACTACTTTAAAGG - Intronic
1167683276 19:50939131-50939153 ACAAGTCCTCACGACTTTTTAGG - Intergenic
926174897 2:10582030-10582052 ATACGTCCTCAGTACTATGTAGG - Intronic
932391555 2:71395169-71395191 ATAGACCCTCACTCCTTGATTGG + Intronic
933372924 2:81440319-81440341 ATAGGTCCTCACTTATAAATGGG + Intergenic
935431800 2:102984112-102984134 ATATTTCCTGAGTACTTTATGGG + Intergenic
936714222 2:115165568-115165590 ATAGATCCTCATAAATTTATAGG + Intronic
939234807 2:139477503-139477525 ACAGGTCCTCACTGCCCTATAGG + Intergenic
943571965 2:189583963-189583985 ATAGGTAGTGACTGCTTTATGGG + Intergenic
944646718 2:201787536-201787558 TTATGTCCTCACTTCTTTACAGG - Intergenic
945802032 2:214446107-214446129 ATATGTTCTCACTTCTTTTTAGG + Intronic
1173133698 20:40419777-40419799 ACAAGTCCTCAATACTTTAAAGG - Intergenic
1174347962 20:49945338-49945360 CAAGGTCCTCACTAACTTATGGG + Intronic
1174941773 20:54937383-54937405 ATAGGTCCTCAATAATTATTTGG - Intergenic
1177670503 21:24219001-24219023 ATCTGTCCTAACTACTTAATGGG + Intergenic
1182465742 22:30515041-30515063 ATAGGTGCTTTCTACTCTATTGG - Intergenic
957463040 3:80547195-80547217 ATAGGTTCTCACTTATTTGTGGG - Intergenic
959223058 3:103546460-103546482 ACAGGTGCTCACAAGTTTATAGG - Intergenic
959274844 3:104265509-104265531 ATATGTCCTCACTAATATGTGGG - Intergenic
966613251 3:181889139-181889161 ATAGGTCCTCAGTCTTTTTTTGG + Intergenic
971014371 4:22471778-22471800 ATACTTCCTCACTCCTTTGTTGG - Intronic
974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG + Intronic
976913823 4:90344114-90344136 ATATGTTCTCACTTATTTATGGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
980581957 4:134766632-134766654 ATAGGTACTCAATAAATTATTGG + Intergenic
981282627 4:142976197-142976219 ATAGGTTCTCACCAATTAATAGG - Intergenic
982480286 4:155900536-155900558 TTAGTCCCTCACTACTTTCTGGG - Intronic
983477095 4:168226797-168226819 ACACGTTCTCACTACTTTGTAGG + Intronic
991270339 5:64771761-64771783 TTTGGTCATCACTACTTTGTAGG - Intronic
993870041 5:93241862-93241884 ATAGGTCCACATTCTTTTATAGG - Intergenic
994274298 5:97816629-97816651 ACAGGTTCTTACTTCTTTATTGG - Intergenic
996593402 5:125174268-125174290 ATATGTACTCACTTTTTTATTGG + Intergenic
1001238520 5:170050064-170050086 AGAGGCCATCACTACTTTAAAGG - Intronic
1006260881 6:32869503-32869525 ATAGGTCCTCTTTATTTTGTTGG - Intergenic
1009788541 6:68369558-68369580 ATATGTCCTCACTTATTTGTGGG + Intergenic
1011447585 6:87458578-87458600 ATATGTCCTCGCTCCTTTGTGGG + Intronic
1011775260 6:90722810-90722832 ATATTTACTCACTTCTTTATAGG + Intergenic
1013828552 6:114244806-114244828 ATAAGTGGTCACTTCTTTATTGG - Intronic
1013973860 6:116053271-116053293 ATAGGTTCTCACTATTGTATTGG + Intronic
1014128908 6:117809317-117809339 ATTGGTCCCCACTATTTTCTGGG + Intergenic
1015065963 6:129028326-129028348 ATATGTCTTCAGTACTTTTTTGG + Intronic
1016493541 6:144633871-144633893 ATATTTCCTCACTACTTGACTGG + Intronic
1016894915 6:149042174-149042196 ATATGACGTCACTATTTTATGGG + Intronic
1020345325 7:7156079-7156101 ATAAGTCCTCACTACATGAGTGG - Intergenic
1026429412 7:70328922-70328944 ATAGGTACAGACTACTTAATGGG - Intronic
1027404728 7:77847934-77847956 ACAGGTTCTCACTAATTTGTGGG - Intronic
1027894366 7:84022413-84022435 ATAGGTATTCTCTACTTTAATGG - Intronic
1030823281 7:114121908-114121930 ATAGGTACTTACTACCTGATGGG - Intronic
1031835048 7:126672209-126672231 CTAGGTCCTCCCTGCTTCATGGG + Intronic
1036240458 8:7076494-7076516 ACATGTCCTCACTTCTTTGTAGG + Intergenic
1039610667 8:38916492-38916514 ACATGTCCTCACTCATTTATGGG - Intronic
1041016804 8:53599355-53599377 ATAGGTGCTCACTCCTTAGTAGG - Intergenic
1041342443 8:56859871-56859893 ATATCTGCTCAGTACTTTATTGG + Intergenic
1042039260 8:64575802-64575824 ACTGGTCCTCACTACTGTTTGGG - Intergenic
1043186807 8:77162657-77162679 ATAGGTCTCCAGTACATTATTGG + Intergenic
1046068418 8:109222665-109222687 CTAGGCCCTCACTACTTCAGGGG + Intergenic
1047973850 8:130110325-130110347 ATAGGTCCCCACTGCTATGTTGG + Intronic
1054726436 9:68656417-68656439 ATTGGTCCTCACTTCTTGGTTGG - Intergenic
1055678532 9:78690917-78690939 ATAGGTCCGCAATGATTTATGGG - Intergenic
1188188871 X:27149300-27149322 ATAGGTGCTTAATAATTTATTGG - Intergenic
1190558312 X:51660728-51660750 ATATGTCCTCACTTATTTGTGGG - Intergenic
1193197444 X:78650018-78650040 ATAGGTGCTCACTACCTGTTAGG + Intergenic
1193233523 X:79077450-79077472 ATAGGTTCTCACTCCTAAATGGG + Intergenic
1201301663 Y:12510468-12510490 CTAATTCCTCACTACTTTTTGGG - Intergenic