ID: 1116653745

View in Genome Browser
Species Human (GRCh38)
Location 14:47626588-47626610
Sequence TCGCGCTGGCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 2, 2: 21, 3: 23, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116653745_1116653760 25 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653760 14:47626636-47626658 GGCCCCGCACTGGGAGCGGCCGG 0: 13
1: 88
2: 433
3: 502
4: 545
1116653745_1116653752 0 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653752 14:47626611-47626633 GTTCCGGGTGGGCGTGGCCTTGG 0: 13
1: 650
2: 621
3: 401
4: 348
1116653745_1116653756 15 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653756 14:47626626-47626648 GGCCTTGGCGGGCCCCGCACTGG 0: 1
1: 21
2: 28
3: 30
4: 157
1116653745_1116653757 16 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653757 14:47626627-47626649 GCCTTGGCGGGCCCCGCACTGGG 0: 3
1: 248
2: 391
3: 337
4: 290
1116653745_1116653754 3 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653754 14:47626614-47626636 CCGGGTGGGCGTGGCCTTGGCGG 0: 6
1: 462
2: 497
3: 387
4: 544
1116653745_1116653751 -6 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653751 14:47626605-47626627 GCGCGAGTTCCGGGTGGGCGTGG 0: 121
1: 263
2: 778
3: 665
4: 417
1116653745_1116653755 4 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653755 14:47626615-47626637 CGGGTGGGCGTGGCCTTGGCGGG 0: 7
1: 376
2: 475
3: 429
4: 548
1116653745_1116653759 21 Left 1116653745 14:47626588-47626610 CCGGCGCTTGCGGGCCAGCGCGA 0: 1
1: 2
2: 21
3: 23
4: 55
Right 1116653759 14:47626632-47626654 GGCGGGCCCCGCACTGGGAGCGG 0: 9
1: 70
2: 155
3: 217
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116653745 Original CRISPR TCGCGCTGGCCCGCAAGCGC CGG (reversed) Intronic
910371813 1:86524135-86524157 TGGCGCTGGCCTGCAAATGCTGG + Intergenic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924671277 1:246128637-246128659 TGGGGCTGGCCCTCAAGCCCAGG + Intronic
1067183151 10:44005611-44005633 TCTCGCTGACCCGCATGCCCCGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070179558 10:74000291-74000313 TCGCTCTGTCACGCAGGCGCTGG + Intronic
1077764561 11:5144445-5144467 TCGCGCTGGTCAGCAAGCGCTGG - Intergenic
1081528664 11:43943451-43943473 TCGCCCTGGCCCGGGAGCGCCGG + Intronic
1082844940 11:57717568-57717590 TGGCGCTTGCCTGCAATCGCAGG + Intronic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096241320 12:49961769-49961791 CCGCGCTGGCCCCCGAGCGTAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1103364006 12:120369315-120369337 CCGCGCTCGCCCGCGAGCCCGGG + Intergenic
1114155520 14:20099229-20099251 TCACTCTGGCCCGCGAGCGTAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1126300109 15:47185043-47185065 GCGCGCAAGCCCGCTAGCGCGGG - Intronic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1148838449 17:50478981-50479003 GCGCGCCGGCCCGCAGGCTCAGG - Exonic
1148991222 17:51668803-51668825 TCGCGCTGGCCCACGAGTGCAGG - Intronic
1155003286 18:21706549-21706571 TCCCGCTGGCCCGTGATCGCGGG - Intronic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1159322214 18:66866802-66866824 GCGGGCCGGCCCGCAAGCCCGGG + Intergenic
1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG + Exonic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1172126428 20:32627529-32627551 TCGCCCTGGCCCCCCAGCCCTGG + Intergenic
1173658043 20:44714646-44714668 TAGCGGTGCCCAGCAAGCGCTGG + Intergenic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1179935311 21:44600219-44600241 TGGCGATGGCCCACAGGCGCTGG + Intronic
1179991157 21:44948917-44948939 TGGCGCTGGCCTGCAATGGCCGG - Intronic
949133629 3:536093-536115 CCACGCCGGCCCGCTAGCGCCGG + Intergenic
949292724 3:2484941-2484963 TCGCGCTGGCCGGTGAGCGCAGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
951290627 3:20867655-20867677 CCGCGCTTGCCTGCAATCGCAGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960868602 3:122227440-122227462 GCTGGCTGGCCCGCAAGCCCCGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
967712716 3:192727588-192727610 GGGCGCTGGCACGCATGCGCAGG + Intronic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
968671680 4:1855689-1855711 GCGGGCTGGGCCGCCAGCGCCGG - Intronic
970593185 4:17577174-17577196 TCGCCCCCGCCCGCATGCGCGGG + Exonic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
973878090 4:55241533-55241555 TTGCGCTGGGCAGCAAGTGCGGG - Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983425673 4:167581591-167581613 TCGCCCTGGCCCGTGAGTGCAGG - Intergenic
984728631 4:183045108-183045130 TCGCACTGGTCCGCAAGCACGGG - Intergenic
986608458 5:9545613-9545635 CCGCTCTGGCCCCCAGGCGCTGG - Exonic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
997282087 5:132655859-132655881 TTGCTCTGGCCCCGAAGCGCTGG - Intergenic
1000609117 5:163355889-163355911 TCGCACTGGCCCACAAGCACCGG - Intergenic
1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG + Intergenic
1003407580 6:5836513-5836535 CGGCGCTCGCCCGCAATCGCAGG + Intergenic
1004395580 6:15244855-15244877 TCGCGCACGCCCCCACGCGCGGG - Intergenic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1006125395 6:31834642-31834664 TGGCGCTGGCCGGCCGGCGCCGG + Exonic
1010569905 6:77463872-77463894 TCTCGCTGGCCTGCAAGCTTTGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1024625677 7:51207560-51207582 TGGCGCTTGCCTGCAATCGCAGG - Intronic
1025796165 7:64739431-64739453 TGGCGCGCGCCCGCAACCGCAGG + Intergenic
1030602596 7:111609440-111609462 TGGCGCGCGCCCGCAATCGCAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036123850 8:6045346-6045368 TCGCACGGGCCCGCAAGCACCGG + Intergenic
1043224041 8:77700757-77700779 CTGCGCAGGCCCGCAAGCACTGG - Intergenic
1044853550 8:96452364-96452386 TCTTGCTGGCCAGCAAGCGCCGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1060849147 9:126860572-126860594 TGGCGCCTGCCCGGAAGCGCGGG + Intergenic
1061422934 9:130481965-130481987 CCGCGCTGGCTCCCAAGGGCAGG - Intronic
1062425082 9:136502373-136502395 TGCTGCTGTCCCGCAAGCGCCGG - Exonic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1198214558 X:134544957-134544979 TCGCCCCGGCCGGCCAGCGCAGG - Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic