ID: 1116659110

View in Genome Browser
Species Human (GRCh38)
Location 14:47685068-47685090
Sequence GTGTGTCAGCAGCAGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116659110_1116659115 -5 Left 1116659110 14:47685068-47685090 CCCCCTACCTGCTGCTGACACAC No data
Right 1116659115 14:47685086-47685108 CACACATCTTTCTCCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116659110 Original CRISPR GTGTGTCAGCAGCAGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr