ID: 1116664408

View in Genome Browser
Species Human (GRCh38)
Location 14:47756804-47756826
Sequence AGGGAGTAACGAATGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116664408_1116664414 16 Left 1116664408 14:47756804-47756826 CCCCTTGCCATTCGTTACTCCCT No data
Right 1116664414 14:47756843-47756865 CTGAAACAGCTACAAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116664408 Original CRISPR AGGGAGTAACGAATGGCAAG GGG (reversed) Intergenic
No off target data available for this crispr