ID: 1116671218

View in Genome Browser
Species Human (GRCh38)
Location 14:47845770-47845792
Sequence AAGGATCCCTGGGGAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116671218_1116671228 29 Left 1116671218 14:47845770-47845792 CCAGGTTTTCCCCAGGGATCCTT No data
Right 1116671228 14:47845822-47845844 GAGCCACGCTTCCAGAGTCTTGG No data
1116671218_1116671223 -6 Left 1116671218 14:47845770-47845792 CCAGGTTTTCCCCAGGGATCCTT No data
Right 1116671223 14:47845787-47845809 ATCCTTGCAACCTATGGATTAGG No data
1116671218_1116671225 -3 Left 1116671218 14:47845770-47845792 CCAGGTTTTCCCCAGGGATCCTT No data
Right 1116671225 14:47845790-47845812 CTTGCAACCTATGGATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116671218 Original CRISPR AAGGATCCCTGGGGAAAACC TGG (reversed) Intergenic
No off target data available for this crispr