ID: 1116671497

View in Genome Browser
Species Human (GRCh38)
Location 14:47847900-47847922
Sequence TCTGACATCATGATGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116671497_1116671499 20 Left 1116671497 14:47847900-47847922 CCAACTAGCATCATGATGTCAGA No data
Right 1116671499 14:47847943-47847965 TATTAATGTTCAATGTAAATGGG No data
1116671497_1116671498 19 Left 1116671497 14:47847900-47847922 CCAACTAGCATCATGATGTCAGA No data
Right 1116671498 14:47847942-47847964 ATATTAATGTTCAATGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116671497 Original CRISPR TCTGACATCATGATGCTAGT TGG (reversed) Intergenic
No off target data available for this crispr