ID: 1116672001

View in Genome Browser
Species Human (GRCh38)
Location 14:47854685-47854707
Sequence TTGGCTGCATTCACCAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116672001_1116672004 4 Left 1116672001 14:47854685-47854707 CCTTGATTGGTGAATGCAGCCAA No data
Right 1116672004 14:47854712-47854734 CAGTAACCTGGCAAGAAGAAAGG No data
1116672001_1116672002 -8 Left 1116672001 14:47854685-47854707 CCTTGATTGGTGAATGCAGCCAA No data
Right 1116672002 14:47854700-47854722 GCAGCCAATGTACAGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116672001 Original CRISPR TTGGCTGCATTCACCAATCA AGG (reversed) Intergenic
No off target data available for this crispr