ID: 1116672002

View in Genome Browser
Species Human (GRCh38)
Location 14:47854700-47854722
Sequence GCAGCCAATGTACAGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116672000_1116672002 -7 Left 1116672000 14:47854684-47854706 CCCTTGATTGGTGAATGCAGCCA No data
Right 1116672002 14:47854700-47854722 GCAGCCAATGTACAGTAACCTGG No data
1116672001_1116672002 -8 Left 1116672001 14:47854685-47854707 CCTTGATTGGTGAATGCAGCCAA No data
Right 1116672002 14:47854700-47854722 GCAGCCAATGTACAGTAACCTGG No data
1116671998_1116672002 6 Left 1116671998 14:47854671-47854693 CCAGAAGCTATAGCCCTTGATTG No data
Right 1116672002 14:47854700-47854722 GCAGCCAATGTACAGTAACCTGG No data
1116671997_1116672002 10 Left 1116671997 14:47854667-47854689 CCAACCAGAAGCTATAGCCCTTG No data
Right 1116672002 14:47854700-47854722 GCAGCCAATGTACAGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116672002 Original CRISPR GCAGCCAATGTACAGTAACC TGG Intergenic
No off target data available for this crispr