ID: 1116672004

View in Genome Browser
Species Human (GRCh38)
Location 14:47854712-47854734
Sequence CAGTAACCTGGCAAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116672001_1116672004 4 Left 1116672001 14:47854685-47854707 CCTTGATTGGTGAATGCAGCCAA No data
Right 1116672004 14:47854712-47854734 CAGTAACCTGGCAAGAAGAAAGG No data
1116671997_1116672004 22 Left 1116671997 14:47854667-47854689 CCAACCAGAAGCTATAGCCCTTG No data
Right 1116672004 14:47854712-47854734 CAGTAACCTGGCAAGAAGAAAGG No data
1116671998_1116672004 18 Left 1116671998 14:47854671-47854693 CCAGAAGCTATAGCCCTTGATTG No data
Right 1116672004 14:47854712-47854734 CAGTAACCTGGCAAGAAGAAAGG No data
1116672000_1116672004 5 Left 1116672000 14:47854684-47854706 CCCTTGATTGGTGAATGCAGCCA No data
Right 1116672004 14:47854712-47854734 CAGTAACCTGGCAAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116672004 Original CRISPR CAGTAACCTGGCAAGAAGAA AGG Intergenic
No off target data available for this crispr